SGN Marker C2_At1g07960

SGN-M6537
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300557 (SGN)
121651 (CGN)
---
Capsicum annuumSingleSGN-U197755---
ArabidopsisSingleAt1g07960 on TAIR---
Mapped locations  
Map: Solanum michoacanum 2011   
Map version
155 (location: 109222)
Chromosome
11
Position
6.01 cM
Confidence
uncalculated
Protocol
CAPS


Solanum michoacanum 2011

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38073)
Chromosome
11
Position
82.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39372
Forward primer (5'-3')
ATGGTTTGTCAAATTTTGTGTTCC
Accessions and product sizes
Solanum pennellii TA56
750
Solanum lycopersicum TA209
750
Approximate temperature
55°C
Reverse primer (5'-3')
AAGAGTTTGAATGTAGGGTATGAATG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
650
Solanum lycopersicum TA209
500
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 24935)
Chromosome
1
Position
2.47 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 9953
Forward primer (5'-3')
ATGGTTTGTCAAATTTTGTGTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAGTTTGAATGTAGGGTATGAATG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 9954
Forward primer (5'-3')
ATGGTTTGTCAAATTTTGTGTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAGTTTGAATGTAGGGTATGAATG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 9955
Forward primer (5'-3')
ATGGTTTGTCAAATTTTGTGTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAGTTTGAATGTAGGGTATGAATG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 32192
Forward primer (5'-3')
ATGGTTTGTCAAATTTTGTGTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAGTTTGAATGTAGGGTATGAATG
Enzymes
All possible enzymes for pennellii and and lycopersicum: DraI
All possible enzymes for lycopersicum and pimpinellifolium: DraI,HinfI
  
Accessions and product sizes
Solanum pennellii LA716: 1500
Solanum lycopersicum LA925: 1500
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g07960F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At1g07960  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6537 marker 6537
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)