SGN Marker C2_At1g08640

SGN-M6549
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeMultiple301085 (SGN)
124875 (CGN)
---
Lycopersicon CombinedSingleSGN-U219783---
Solanum tuberosumSingleSGN-U251519---
ArabidopsisSingleAt1g08640 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38075)
Chromosome
4
Position
22.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39373
Forward primer (5'-3')
ATTGAGGGATTTGACATGGTTAAGG
Accessions and product sizes
Solanum pennellii TA56
700
Solanum lycopersicum TA209
700
Approximate temperature
58°C
Reverse primer (5'-3')
TGTGACATCATGATTTTGTCATAAGC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
700
Solanum lycopersicum TA209
425
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 24947)
Chromosome
1
Position
2.75 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g08640  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6549 marker 6549
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)