SGN Marker CT91

SGN-M655

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
800
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT91 image not available
Forward sequence
not available
Reverse sequence
TTTTTTTTTTTTTTTTTAAAACGTAGCTAAACTAAAATAAGGATACCACAGATAACAAGTCTCAATGTCAAAATCTCAAACAAGAAATTA
GGTGAAGCCCCCTATCATGTCCTCGAGGACATAATTTTGTTCACCGAATCAAGGATCCTGGCCATGCCAAAACGGCTTAATGTAGAATTT
CTAAGATATGACTTGGCAAAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1614752.2e-81183 (91.0% of RFLP seq)-
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53753)
Chromosome
10
Position
27.30 cM
Confidence
uncalculated
Protocol
RFLP
Subscript
B


Tomato QTL map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 51853)
Chromosome
1
Position
66.97 cM
Confidence
uncalculated
Protocol
unknown
Subscript
B

MQTL_1_Late_blight_1 MQTL_2_Late_blight_1
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 51909)
Chromosome
1
Position
65.41 cM
Confidence
uncalculated
Protocol
unknown
Subscript
B

MQTL_1_Late_blight_1 MQTL_2_Late_blight_1
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 51910)
Chromosome
5
Position
27.75 cM
Confidence
uncalculated
Protocol
unknown
Subscript
C

MQTL_1_Late_blight_5 MQTL_1_Maturity_5 MQTL_2_Late_blight_5
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9736)
Chromosome
10
Position
31.90 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9734)
Chromosome
1
Position
46.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9735)
Chromosome
5
Position
46.80 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
C


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT91 was used as an overgo probe on plate 4 [well A12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GTTCACCGAATCAAGGATCCTGGC
B sequence
AAGCCGTTTTGGCATGGCCAGGAT
AB sequence
GTTCACCGAATCAAGGATCCTGGCCATGCC
Marker sequence
TTTTTTTTTTTTTTTTTAAAACGTAGCTAAACTAAAATAAGGATACCACA
GATAACAAGTCTCAATGTCAAAATCTCAAACAAGAAATTAGGTGAAGCCC
CCTATCATGTCCTCGAGGACATAATTTTGTTCACCGAATCAAGGATCCTG
GCCATGCCAAAACGGCTTAATGTAGAATTTCTAAGATATGACTTGGCAAA
A
Genomic location of CT91  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D655 marker 655
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)