SGN Marker CT226

SGN-M656

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
500
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT226 image not available
Forward sequence
not available
Reverse sequence
TTTTTTTTTTTTTTGGGAATGAACAATTTATATGCAGCAGTTTATATAGATTTTCATTACATAAACTTATTCGCTCACAAAAGACACGAG
GATAACATTTCAAAACTACAACATTGAAATTCGAAAAGGGTGACTTCAGTCATAGCTCAACTATTTAGTAGTATTCGAGCTGACAAATGA
AGAATATCCATTTCAATGTTTGCGCAGAAGCAGAGGAGCACCATACTGTGGATGAATAGTAATTGTTGCAAATGGAGCATGCGTATAAGA
CGGACAGAGTTCAAAGGAGAACTTTTGTAGTATCATTGCTATTGCCATTTTTGCTTCCATCATTGCAAAGTTTTGTCCGATGCAAATTCG
AGGGCCCCAACCAAACGGAATAAACGAGACTTGACCTTT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1504064.5e-0779 (19.8% of RFLP seq)-
SGN-U1439233.1e-1487 (21.8% of RFLP seq)-
SGN-U1727821.7e-37118 (29.6% of RFLP seq)-
SGN-U1512751.3e-56202 (50.6% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53463)
Chromosome
7
Position
70.06 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009
Genomic location of CT226  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D656 marker 656
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)