SGN Marker CT238

SGN-M659

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1600
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT238 image not available
Forward sequence
not available
Reverse sequence
TTTTTTTTTTTTGCCGGATAAGGCGTTTCTGTCCGATTTATGCTCTTCTACTTTCTTCACTCCTTTTCGATGTCAATCTTCGTGATATAA
TCATTTCATTTCATCTTTTCAAATCGTAAAAAAATAAAAATATTATTGGTTTTCATCTTCTCTAAGCTGATCCCCCAGCTAGGGTTTTGA
ATTAGGGATTTTATTGTTGAAGAGCATCGAGCAATGCATTCGGTGCCTTCTGTATTTGATCTATTCACTCCACCGCATGCTGCATCTTTC
TATGGTTTTTTGTGCTTTCATCGTCTGAAAAACATGGAGAAATTTGATTGGGCTAATAATCTTAGCTAACGTTTACTTTTTTTTTTTGA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 42961)
Chromosome
10
Position
58.80 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43961
Forward primer (5'-3')
CGGATAAGGCGTTTCTGTC
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
CAGACGATGAAAGCACAAAAAACC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9748)
Chromosome
10
Position
87.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT238 was used as an overgo probe on plate 4 [well H1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TTGTTGAAGAGCATCGAGCAATGC
B sequence
ACAGAAGGCACCGAATGCATTGCT
AB sequence
TTGTTGAAGAGCATCGAGCAATGCATTCGG
Marker sequence
TTTTTTTTTTTTGCCGGATAAGGCGTTTCTGTCCGATTTATGCTCTTCTA
CTTTCTTCACTCCTTTTCGATGTCAATCTTCGTGATATAATCATTTCATT
TCATCTTTTCAAATCGTAAAAAAATAAAAATATTATTGGTTTTCATCTTC
TCTAAGCTGATCCCCCAGCTAGGGTTTTGAATTAGGGATTTTATTGTTGA
AGAGCATCGAGCAATGCATTCGGTGCCTTCTGTATTTGATCTATTCACTC
CACCGCATGCTGCATCTTTCTATGGTTTTTTGTGCTTTCATCGTCTGAAA
AACATGGAGAAATTTGATTGGGCTAATAATCTTAGCTAACGTTTACTTTT
TTTTTTTGA
Genomic location of CT238  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D659 marker 659
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)