Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker TG500

SGN-M66

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1700
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG500 image not available
Forward sequence
AACTTTCTCGGCAGATGCATGTGTGAAGAACTCCACAAAACCATACCCTTCAGAGAAACCAGTCTGTTTATTGCGAATTACCTTGATGGA
GGCAACCTGCACAAACAAGAACCATATAAGCTGACAAGAAAATTATGAGGTCAAAGACTTCACTTTTTCCCCATATGGAGAAATCATTTT
TGGGTGGGCAATGGGTCAATATTTAACCTCCAAGCACATTCAAGAATTTCAAATGGCCTGAATCATCATGCAAGAGTTTCTCATTCTGCT
TCCAACTTAATAAATGTTGAATAGCTACCAGGAGTTTATATGATGTCACTAATTACTTAGTATTTTCTTGTCATTCAATATGAATACTAG
AGAGCCTCAATGTTCACCAACTTGGGTGTGTCATGACATATCATGCTCATTGGCATGGGCAGACATATCATGTTCATTGACATATGCAAT
ACAATTCATGTGTGTTGTGCTGTTAGTACAGAG
Reverse sequence
CGGTTGTACCCGTGGCGGCGGCGGCGCCAGCAGGGGCGCAGCAGCAGCCGTGGGTGGCGATGCAGTACCCGGCGGCGGCGATGGTAATGC
AGCATCCAATGATGCCGGCCCCACATTATCCACCGCACTATATGCCGTTTCATCCACAACACCATCACCACCTTATCCACCACCCACCGC
ACTCACCGTCACCGCATCAACAAGGTGGAGGTGGAGGATCTAATAATAATGAGAATCGAACGATCTGGGTGGGTGACCTTCATAATTGGA
TGGATGAGGATTATCTACGTAGCTGCTTCGCTACCACTAATGAGGTATAAGTCTGTACCAGTTTACGCTCATGCATATATTTATATATAT
TTGGTGCTCTGTTTTTTTAAACACGTGATTTATGTTTTTCTATAAATGTTTTCATGTGATTAATTACAGTAAAATCTGGATTTATTGAAT
GGGGTAGAATGATGGCAGGTAGCTACTAGTTAGCCGCCGTCACAAGTAAAGT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1451792.4e-4998 (20.3% of RFLP seq)+
SGN-U1614041.1e-60117 (23.3% of RFLP seq)-
SGN-U1451792e-179316 (62.9% of RFLP seq)-
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43874)
Chromosome
4
Position
101.70 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43336)
Chromosome
4
Position
93.30 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40878)
Chromosome
4
Position
98.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40067)
Chromosome
4
Position
106.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7933)
Chromosome
4
Position
102.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 7937)
Chromosome
4
Position
84.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG500 was used as an overgo probe on plate 7 [well B5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TAGAGAGCCTCAATGTTCACCAAC
B sequence
GTCATGACACACCCAAGTTGGTGA
AB sequence
TAGAGAGCCTCAATGTTCACCAACTTGGGT
Marker sequence
AACTTTCTCGGCAGATGCATGTGTGAAGAACTCCACAAAACCATACCCTT
CAGAGAAACCAGTCTGTTTATTGCGAATTACCTTGATGGAGGCAACCTGC
ACAAACAAGAACCATATAAGCTGACAAGAAAATTATGAGGTCAAAGACTT
CACTTTTTCCCCATATGGAGAAATCATTTTTGGGTGGGCAATGGGTCAAT
ATTTAACCTCCAAGCACATTCAAGAATTTCAAATGGCCTGAATCATCATG
CAAGAGTTTCTCATTCTGCTTCCAACTTAATAAATGTTGAATAGCTACCA
GGAGTTTATATGATGTCACTAATTACTTAGTATTTTCTTGTCATTCAATA
TGAATACTAGAGAGCCTCAATGTTCACCAACTTGGGTGTGTCATGACATA
TCATGCTCATTGGCATGGGCAGACATATCATGTTCATTGACATATGCAAT
ACAATTCATGTGTGTTGTGCTGTTAGTACAGAG
Genomic location of TG500  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D66 marker 66
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)