SGN Marker CT239

SGN-M660

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
not available
Reverse sequence
TGATTAATGGTCAATTTCCTGGTCCTGATATCAACTCGGTCACCAATGACAATCTCGTTATCAATATCCACAACAGCTTGGATGAACCTT
TTCTACTTTCCTGGAACGGAGTACAAAACAGAAGAAACTCATTTGTAGATGGAGTATATGGAACAACATGCCCAATACCGCCAGGGAGAA
ATAACACATTCAATCTACAAGTGAAGGATCAAATAGGGAGTTTCTATTACTTCCCATCTCTTGCATTCCACAAAGCTGCTGGTGGTTTTG
GAGGGATTAGGATTCTCAGCAGGCCTAGAATCCCCGTCCCTTTTCCGGACCCTGCAAACGACTACACCATCCTCATTGGAGATTGGTACA
AAAAGAACCACACGGACTTGAAAGCAATTCTTGACGGAGGCAGGAAGTTACCTTTCCCTGATGGCATTCTTATCAATGGTCGTGGTCCTA
ATGGTGTTACATTCACAGTCGATCAAGGGAAAACCTATAGATTGAG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1440282.9e-2769 (13.9% of RFLP seq)-
SGN-U1695713.4e-39313 (63.1% of RFLP seq)-
SGN-U144028392 (79.0% of RFLP seq)-
SGN-U144027496 (100.0% of RFLP seq)-
Mapped locations  
Map: Pepper-AC99   
Map version
34 (location: 9751)
Chromosome
12
Position
82.81 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9749)
Chromosome
4
Position
119.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9750)
Chromosome
12
Position
68.30 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT239 was used as an overgo probe on plate 16 [well C11]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CCCATCTCTTGCATTCCACAAAGC
B sequence
TCCAAAACCACCAGCAGCTTTGTG
AB sequence
CCCATCTCTTGCATTCCACAAAGCTGCTGG
Marker sequence
TGATTAATGGTCAATTTCCTGGTCCTGATATCAACTCGGTCACCAATGAC
AATCTCGTTATCAATATCCACAACAGCTTGGATGAACCTTTTCTACTTTC
CTGGAACGGAGTACAAAACAGAAGAAACTCATTTGTAGATGGAGTATATG
GAACAACATGCCCAATACCGCCAGGGAGAAATAACACATTCAATCTACAA
GTGAAGGATCAAATAGGGAGTTTCTATTACTTCCCATCTCTTGCATTCCA
CAAAGCTGCTGGTGGTTTTGGAGGGATTAGGATTCTCAGCAGGCCTAGAA
TCCCCGTCCCTTTTCCGGACCCTGCAAACGACTACACCATCCTCATTGGA
GATTGGTACAAAAAGAACCACACGGACTTGAAAGCAATTCTTGACGGAGG
CAGGAAGTTACCTTTCCCTGATGGCATTCTTATCAATGGTCGTGGTCCTA
ATGGTGTTACATTCACAGTCGATCAAGGGAAAACCTATAGATTGAG
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of CT239  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D660 marker 660
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)