Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

SGN Marker CT247

SGN-M662

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1300
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT247 image not available
Forward sequence
not available
Reverse sequence
TCCCCCGGGTCTGCAGGAATACCCTCCTTTTTGTCTATTTACTTCACTATATTTGGGCAAACTTTCAAATAATATATATGGCGAAAACCT
CAAAATTGAGAAAACAAAACACTTGTTTAAGCAACAAGGATACTGATAATAGCATTTCTAAAGTGAAAACGAAGCGAAAACCCACAGACT
CTCCGCCTCAACGACGTAGTTCAATATACAGAGGTGTCACCCGGCACAAATGGACGGGTCGAAATGAAGCTCATTTACGGGATAAAAATT
GTTGGAACGAATCGCAGACTAAAAAAGGAACACCAGTATACTTGGGGGCCTACAATGACGAATAAGCAGCTGCACAAGCATATGACTTGG
CCCCATTAAAGTATTGGGGTCAACACACAATCCGTAATTTCTCTGTGTCTACT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1556321e-177377 (91.3% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9753)
Chromosome
6
Position
46.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT247 was used as an overgo probe on plate 5 [well G9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AAGCGAAAACCCACAGACTCTCCG
B sequence
AACTACGTCGTTGAGGCGGAGAGT
AB sequence
AAGCGAAAACCCACAGACTCTCCGCCTCAA
Marker sequence
TCGGGTCTGCAGGAATACCCTCCTTTTTGTCTATTTACTTCACTATATTT
GGGCAAACTTTCAAATAATATATATGGCGAAAACCTCAAAATTGAGAAAA
CAAAACACTTGTTTAAGCAACAAGGATACTGATAATAGCATTTCTAAAGT
GAAAACGAAGCGAAAACCCACAGACTCTCCGCCTCAACGACGTAGTTCAA
TATACAGAGGTGTCACCCGGCACAAATGGACGGGTCGAAATGAAGCTCAT
TTACGGGATAAAAATTGTTGGAACGAATCGCAGACTAAAAAAGGAACACC
AGTATACTTGNNNNCCTACAATGACGAATAAGCAGCTGCACAAGCATATG
ACTTGGCCCCATTAAAGTATTGGGGTCAACACACAATCCGTAATTTCTCT
GTGTCTACT
Genomic location of CT247  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D662 marker 662
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)