SGN Marker TG417

SGN-M663

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1900
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG417 image not available
Forward sequence
not available
Reverse sequence
TTGAGACTCAGAAACTCGACTCATAGTCCATAGACCTGAAGATATGATCGATATAATTCAGTACTCAATTTCTAATTAGAGGACAAATAG
CAGATCTTGATTCTTTTTTTTCTGAATAACGTCGAGTACTCCTTCATATTGTTTACTTTTTGTTTTTCAGTTTAGACACCAATGCATCTG
TTTTATAAACTTAACAGAGGGAATCTAGATGATTCAGATTTTGTTTTCTGAACAAATACTTGATGATTACTGCTGAAAAATAAGCCAAAA
TTTTTGTCTGCT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXHIR 1997   
Map version
32 (location: 9754)
Chromosome
3
Position
88.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9755)
Chromosome
3
Position
92.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG417 was used as an overgo probe on plate 4 [well C9]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P228P06,   P034C04,   P163K05,   P305A06,   P166C03,   P164M20,   P058B11,   P245P12

 Overgo Sequences

A sequence
GAGACTCAGAAACTCGACTCATAG
B sequence
TCTTCAGGTCTATGGACTATGAGT
AB sequence
GAGACTCAGAAACTCGACTCATAGTCCATA
Marker sequence
TTGAGACTCAGAAACTCGACTCATAGTCCATAGACCTGAAGATATGATCG
ATATAATTCAGTACTCAATTTCTAATTAGAGGACAAATAGCAGATCTTGA
TTCTTTTTTTTCTGAATAACGTCGAGTACTCCTTCATATTGTTTACTTTT
TGTTTTTCAGTTTAGACACCAATGCATCTGTTTTATAAACTTAACAGAGG
GAATCTAGATGATTCAGATTTTGTTTTCTGAACAAATACTTGATGATTAC
TGCTGAAAAATAAGCCAAAATTTTTGTCTGCT
Genomic location of TG417  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D663 marker 663
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)