SGN Marker CT267

SGN-M664

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1200
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT267 image not available
Forward sequence
TTCCTTTTTTTTTTTTTTTAAGTAACGAATAGTTCTATAAATTACCCCACATCAATCATGATTATGGTTATGATGATGAAACGCAAAATA
CGTGAAAGGCCTGACATGAGATGCATAATATCCTGATGACTCCTCCGATATTGATGCACTCCTATAAAATTAGGGAAGTTAGGCTCAATT
AAAAGCACTTTGTTGGAGGGATCATTACAGTACTCACTCTTAAAGCATATTAAGG
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1457091.7e-45215 (91.5% of RFLP seq)+
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42343)
Chromosome
1
Position
115.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39043)
Chromosome
1
Position
114.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 9756)
Chromosome
1
Position
123.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 9758)
Chromosome
1
Position
128.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9757)
Chromosome
1
Position
84.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Other PCR data 
PCR data   Exp. ID 35568
Forward primer (5'-3')
TGGGTATCCTAGAAGGCCAGT
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGGTAGCCCTTGGTTGGAT
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 800
Solanum pennellii LA716: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 13
Forward primer (5'-3')
Unknown
Digested band sizes (using unknown)
Solanum pennellii LA716: 900
Solanum lycopersicum LA925: 800
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 900
Solanum lycopersicum LA925: 800
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
CT267 was used as an overgo probe on plate 3 [well C6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CCTGACATGAGATGCATAATATCC
B sequence
ATCGGAGGAGTCATCAGGATATTA
AB sequence
CCTGACATGAGATGCATAATATCCTGATGA
Marker sequence
TTCCTTTTTTTTTTTTTTTAAGTAACGAATAGTTCTATAAATTACCCCAC
ATCAATCATGATTATGGTTATGATGATGAAACGCAAAATACGTGAAAGGC
CTGACATGAGATGCATAATATCCTGATGACTCCTCCGATATTGATGCACT
CCTATAAAATTAGGGAAGTTAGGCTCAATTAAAAGCACTTTGTTGGAGGG
ATCATTACAGTACTCACTCTTAAAGCATATTAAGG
Genomic location of CT267  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D664 marker 664
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)