SGN Marker CT283

SGN-M665

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1700
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT283 image not available
Forward sequence
TCCCCCGGTGCTGCAGGAATACCTTCACCAAAAAAGCTCTGACTATTTTCACTGTGAAAGTTCATCAATGGCGGAGAAATCATTCAAGAA
CGCGATCGTCGGTGGCGGTGTTTCTGCTGGGAATGCTGCTACATAATTGGCCAAACAGGGAGTCCAGCCTGGGGAACTGGCTATTATTTC
CCAAGAGGCAGAGGCTCCTTATGAACGTCCTGCACTTAGCAAGGGATACCTTTTTCCTGAA
Reverse sequence
TTCCTCACCAAAAAAGCTCTGACTATTTTCACTGTGAAAGTTCATCAATGGCGGATAAATCTTTCAAGCATGCGATCGTCGGTGGCGGTG
TTTCTGCTGGGAATGCTGCTACATAATTTGCCAAACAGGGAGTTACCCCTGGGGAACTGGTTATTATTTCCAAAGAGGCAGGGGCTCCTT
ATGAACGTCCTGCACTTACCACGGCATACCTTTTTCCTGAAGGACCTGCTAGACTCCCAGGATTACATGTGTGTGATGGAATTGGAGGAC
AGAGACAGCTTCC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1455043e-90218 (90.5% of RFLP seq)+
SGN-U1455043e-112279 (98.6% of RFLP seq)-
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42348)
Chromosome
9
Position
2.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39048)
Chromosome
9
Position
33.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 9763)
Chromosome
9
Position
2.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9762)
Chromosome
9
Position
25.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 9767)
Chromosome
9
Position
26.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
CT283 was used as an overgo probe on plate 15 [well B5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGGAATGCTGCTACATAATTGGCC
B sequence
GCTGGACTCCCTGTTTGGCCAATT
AB sequence
GGGAATGCTGCTACATAATTGGCCAAACAG
Marker sequence
TCCCCCGGTGCTGCAGGAATACCTTCACCAAAAAAGCTCTGACTATTTTC
ACTGTGAAAGTTCATCAATGGCGGAGAAATCATTCAAGAACGCGATCGTC
GGTGGCGGTGTTTCTGCTGGGAATGCTGCTACATAATTGGCCAAACAGGG
AGTCCAGCCTGGGGAACTGGCTATTATTTCCCAAGAGGCAGAGGCTCCTT
ATGAACGTCCTGCACTTAGCAAGGGATACCTTTTTCCTGAA
Genomic location of CT283  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D665 marker 665
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)