SGN Marker C2_At1g18480

SGN-M6652
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302201 (SGN)
122180 (CGN)
---
Solanum tuberosumSingleSGN-U255875---
ArabidopsisSingleAt1g18480 on TAIR---
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42169)
Chromosome
8
Position
31.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43732
Forward primer (5'-3')
ACAAACAATCTTCCCTTCTCCTACTCG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AATAGGCCCTTTTGGCCTTAATGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38115)
Chromosome
8
Position
16.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41046
Forward primer (5'-3')
ACAAACAATCTTCCCTTCTCCTACTCG
Accessions and product sizes
Solanum lycopersicum TA209
450
Solanum pennellii TA56
475
Approximate temperature
55°C
Reverse primer (5'-3')
AATAGGCCCTTTTGGCCTTAATGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25054)
Chromosome
1
Position
6.36 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g18480  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6652 marker 6652
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)