SGN Marker C2_At1g19690

SGN-M6664
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308412 (SGN)
130154 (CGN)
---
Lycopersicon CombinedSingleSGN-U223910---
Solanum tuberosumSingleSGN-U257371---
ArabidopsisSingleAt1g19690 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38122)
Chromosome
2
Position
113.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39410
Forward primer (5'-3')
ATGTTCATTCTGGGGATGGGTTTCG
Accessions and product sizes
Solanum pennellii TA56
900
Solanum lycopersicum TA209
900
Approximate temperature
63°C
Reverse primer (5'-3')
AATTTCAAGATATCGAGGACTTCC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
550
Solanum lycopersicum TA209
900
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25067)
Chromosome
1
Position
6.81 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g19690  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6664 marker 6664
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)