SGN Marker C2_At1g20575

SGN-M6670
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U197163---
Lycopersicon CombinedSingleSGN-U224892---
Solanum tuberosumSingleSGN-U251460---
ArabidopsisSingleAt1g20575 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46564)
Chromosome
4
Position
89.50 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46431)
Chromosome
4
Position
74.80 cM
Confidence
F(LOD3)
Protocol
dCAPS


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41311)
Chromosome
4
Position
145.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43287
Forward primer (5'-3')
AGACACTACTTTGGCCGGGTGTATC
Accessions and product sizes
Approximate temperature
53°C
Reverse primer (5'-3')
ATGATGTCTTCTAGTGCAGACTTCTGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38125)
Chromosome
4
Position
132.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39413
Forward primer (5'-3')
AGACACTACTTTGGCCGGGTGTATC
Accessions and product sizes
Solanum pennellii TA56
100
Solanum lycopersicum TA209
100
Approximate temperature
55°C
Reverse primer (5'-3')
ATGATGTCTTCTAGTGCAGACTTCTGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25074)
Chromosome
1
Position
7.13 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10067
Forward primer (5'-3')
AGACACTACTTTGGCCGGGTGTATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGATGTCTTCTAGTGCAGACTTCTGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 10068
Forward primer (5'-3')
AGACACTACTTTGGCCGGGTGTATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGATGTCTTCTAGTGCAGACTTCTGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 10069
Forward primer (5'-3')
AGACACTACTTTGGCCGGGTGTATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGATGTCTTCTAGTGCAGACTTCTGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 12489
Forward primer (5'-3')
AGACACTACTTTGGCCGGGTGTATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGATGTCTTCTAGTGCAGACTTCTGG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12490
Forward primer (5'-3')
AGACACTACTTTGGCCGGGTGTATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGATGTCTTCTAGTGCAGACTTCTGG
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12491
Forward primer (5'-3')
AGACACTACTTTGGCCGGGTGTATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGATGTCTTCTAGTGCAGACTTCTGG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12492
Forward primer (5'-3')
AGACACTACTTTGGCCGGGTGTATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGATGTCTTCTAGTGCAGACTTCTGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12493
Forward primer (5'-3')
AGACACTACTTTGGCCGGGTGTATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGATGTCTTCTAGTGCAGACTTCTGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12494
Forward primer (5'-3')
AGACACTACTTTGGCCGGGTGTATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGATGTCTTCTAGTGCAGACTTCTGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 12495
Forward primer (5'-3')
AGACACTACTTTGGCCGGGTGTATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGATGTCTTCTAGTGCAGACTTCTGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 12496
Forward primer (5'-3')
AGACACTACTTTGGCCGGGTGTATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGATGTCTTCTAGTGCAGACTTCTGG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12497
Forward primer (5'-3')
AGACACTACTTTGGCCGGGTGTATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGATGTCTTCTAGTGCAGACTTCTGG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12498
Forward primer (5'-3')
AGACACTACTTTGGCCGGGTGTATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGATGTCTTCTAGTGCAGACTTCTGG
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 12499
Forward primer (5'-3')
AGACACTACTTTGGCCGGGTGTATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGATGTCTTCTAGTGCAGACTTCTGG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 12500
Forward primer (5'-3')
AGACACTACTTTGGCCGGGTGTATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGATGTCTTCTAGTGCAGACTTCTGG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 32720
Forward primer (5'-3')
AGACACTACTTTGGCCGGGTGTATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGATGTCTTCTAGTGCAGACTTCTGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 32721
Forward primer (5'-3')
AGACACTACTTTGGCCGGGTGTATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGATGTCTTCTAGTGCAGACTTCTGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 32722
Forward primer (5'-3')
AGACACTACTTTGGCCGGGTGTATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGATGTCTTCTAGTGCAGACTTCTGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 32723
Forward primer (5'-3')
AGACACTACTTTGGCCGGGTGTATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGATGTCTTCTAGTGCAGACTTCTGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 10070
Forward primer (5'-3')
AGACACTACTTTGGCCGGGTGTATC
Digested band sizes (using TaqI)
Solanum pennellii LA716: 500
Solanum lycopersicum LA925: 420
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGATGTCTTCTAGTGCAGACTTCTGG
Enzymes
All possible enzymes for pennellii and and lycopersicum: MspI, TaqI, HaeIII, HinfI
  
Accessions and product sizes
Solanum lycopersicum LA925: 600
Solanum pennellii LA716: 600
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At1g20575  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6670 marker 6670
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)