SGN Marker CT263

SGN-M668

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
300
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
TTTTTTTTTTTTTTAATTGAGAGGAACACTAGGGTGACCATCAGCATCCTTATCTCCTCTTCCATGCTTATATTGTGGGACCACCTGATC
TTGTGAGGAAATGATGGATGACATTCTTCTAGTTTTTTTCTCAACATCTATTCTGCTTCCGCTGCTCAAGTTGATATCTGAGGTAGAAAA
TCTGCGTCGTCTTTCTTTAGGAGTATCAAGGGTTGAATCTGTACTATCGGGCAAATGGCGGTTGAGCGGAAAAATAGGGGCGGCGTTACT
ATAATTCTCCAGCAAAGTTTGAACAAAA
Reverse sequence
TTTTTTTTTTTTTTAATTGAGAGGAACACTATGGTGACCATCATCATCCTTATCTCCACTTCCATGCTTATTTTGCGGGCACCTCCTGCA
TCTTGTGAGGAAATGATGGATAGACATTCTTCTAGATTTTTTCTCAACATACTATTCTGCATTCCGCTGCTCATGATTGATATCTGAGGA
ACAAAATCT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1543682e-138284 (95.3% of RFLP seq)+
SGN-U1543681.3e-45175 (92.6% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39040)
Chromosome
3
Position
55.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 9773)
Chromosome
3
Position
38.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9774)
Chromosome
3
Position
47.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT263 was used as an overgo probe on plate 3 [well D11]

Plausible BAC Matches:   P114P24,   P112H15,   P266J03,   P198J21

 Overgo Sequences

A sequence
TGAGAGGAACACTAGGGTGACCAT
B sequence
GGAGATAAGGATGCTGATGGTCAC
AB sequence
TGAGAGGAACACTAGGGTGACCATCAGCAT
Marker sequence
TTTTTTTTTTTTTTAATTGAGAGGAACACTAGGGTGACCATCAGCATCCT
TATCTCCTCTTCCATGCTTATATTGTGGGACCACCTGATCTTGTGAGGAA
ATGATGGATGACATTCTTCTAGTTTTTTTCTCAACATCTATTCTGCTTCC
GCTGCTCAAGTTGATATCTGAGGTAGAAAATCTGCGTCGTCTTTCTTTAG
GAGTATCAAGGGTTGAATCTGTACTATCGGGCAAATGGCGGTTGAGCGGA
AAAATAGGGGCGGCGTTACTATAATTCTCCAGCAAAGTTTGAACAAAA
Genomic location of CT263  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D668 marker 668
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)