SGN Marker C2_At1g23230

SGN-M6688
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304648 (SGN)
120653 (CGN)
---
Solanum tuberosumSingleSGN-U257504---
ArabidopsisSingleAt1g23230 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25093)
Chromosome
1
Position
8.25 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41054
Forward primer (5'-3')
TGCTTTTGAATATCTTGGTGGATG
Accessions and product sizes
Solanum lycopersicum TA209
200
Solanum pennellii TA56
200
Approximate temperature
55°C
Reverse primer (5'-3')
TGCCCCTCGTAATGAATAACATGATG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 10084
Forward primer (5'-3')
TGCTTTTGAATATCTTGGTGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCCCTCGTAATGAATAACATGATG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 10085
Forward primer (5'-3')
TGCTTTTGAATATCTTGGTGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCCCTCGTAATGAATAACATGATG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 10086
Forward primer (5'-3')
TGCTTTTGAATATCTTGGTGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCCCTCGTAATGAATAACATGATG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 200
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format

Genomic location of C2_At1g23230  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6688 marker 6688
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)