SGN Marker C2_At1g23890

SGN-M6693
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U204136---
Lycopersicon CombinedSingleSGN-U219209---
Solanum tuberosumSingleSGN-U251497---
ArabidopsisSingleAt1g23890 on TAIR---
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42174)
Chromosome
3
Position
58.60 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43737
Forward primer (5'-3')
ACCCTTACTCCATCATCCCTGTATCT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGACTTGCTAATCTTTCTAATTGCAT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41314)
Chromosome
11
Position
57.10 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43290
Forward primer (5'-3')
ATGCATGCAATTAGAAAGATTAGCAAG
Accessions and product sizes
Approximate temperature
64°C
Reverse primer (5'-3')
AATCCAGGTCCATCAGCACGGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38132)
Chromosome
5
Position
7.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39420
Forward primer (5'-3')
ATGCATGCAATTAGAAAGATTAGCAAG
Accessions and product sizes
Solanum lycopersicum TA209
200
Solanum pennellii TA56
200
Approximate temperature
53°C
Reverse primer (5'-3')
AATCCAGGTCCATCAGCACGGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25098)
Chromosome
1
Position
8.44 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10090
Forward primer (5'-3')
ATGCATGCAATTAGAAAGATTAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCCAGGTCCATCAGCACGGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1850
Approximate temperature
55°C
  
PCR data   Exp. ID 10091
Forward primer (5'-3')
ATGCATGCAATTAGAAAGATTAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCCAGGTCCATCAGCACGGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1850
Approximate temperature
55°C
  
PCR data   Exp. ID 10092
Forward primer (5'-3')
ATGCATGCAATTAGAAAGATTAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCCAGGTCCATCAGCACGGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1850
Approximate temperature
55°C
  
PCR data   Exp. ID 12524
Forward primer (5'-3')
ATGCATGCAATTAGAAAGATTAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCCAGGTCCATCAGCACGGC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1850
Approximate temperature
55°C
  
PCR data   Exp. ID 12525
Forward primer (5'-3')
ATGCATGCAATTAGAAAGATTAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCCAGGTCCATCAGCACGGC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 1850
Approximate temperature
55°C
  
PCR data   Exp. ID 12526
Forward primer (5'-3')
ATGCATGCAATTAGAAAGATTAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCCAGGTCCATCAGCACGGC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12527
Forward primer (5'-3')
ATGCATGCAATTAGAAAGATTAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCCAGGTCCATCAGCACGGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12528
Forward primer (5'-3')
ATGCATGCAATTAGAAAGATTAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCCAGGTCCATCAGCACGGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12529
Forward primer (5'-3')
ATGCATGCAATTAGAAAGATTAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCCAGGTCCATCAGCACGGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12530
Forward primer (5'-3')
ATGCATGCAATTAGAAAGATTAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCCAGGTCCATCAGCACGGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12531
Forward primer (5'-3')
ATGCATGCAATTAGAAAGATTAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCCAGGTCCATCAGCACGGC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 12532
Forward primer (5'-3')
ATGCATGCAATTAGAAAGATTAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCCAGGTCCATCAGCACGGC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 12533
Forward primer (5'-3')
ATGCATGCAATTAGAAAGATTAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCCAGGTCCATCAGCACGGC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 920
Approximate temperature
55°C
  
PCR data   Exp. ID 12534
Forward primer (5'-3')
ATGCATGCAATTAGAAAGATTAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCCAGGTCCATCAGCACGGC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 12535
Forward primer (5'-3')
ATGCATGCAATTAGAAAGATTAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCCAGGTCCATCAGCACGGC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 32733
Forward primer (5'-3')
ATGCATGCAATTAGAAAGATTAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCCAGGTCCATCAGCACGGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 32734
Forward primer (5'-3')
ATGCATGCAATTAGAAAGATTAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCCAGGTCCATCAGCACGGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 32735
Forward primer (5'-3')
ATGCATGCAATTAGAAAGATTAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCCAGGTCCATCAGCACGGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 32736
Forward primer (5'-3')
ATGCATGCAATTAGAAAGATTAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCCAGGTCCATCAGCACGGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 10093
Forward primer (5'-3')
ATGCATGCAATTAGAAAGATTAGCAAG
Digested band sizes (using DpnII)
Solanum pennellii LA716: 750
Solanum lycopersicum LA925: 900
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCCAGGTCCATCAGCACGGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: DpnII
  
Accessions and product sizes
Solanum lycopersicum LA925: 1850
Solanum pennellii LA716: 1850
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At1g23890  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6693 marker 6693
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)