Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker TG282

SGN-M67

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG282 image not available
Forward sequence
GGGAGACAGCTTGCATGCCTGCAGCCTTAGGAACAACGGAGTCAAGAATCGTTAGAACAGCAAATGTGCAAAACATTCCAAATAGAGCAC
TTGGGAACTTAATAGCAGCTTCCACAAATGCTTTCTTTAACAATTTATCCATAGCCAGTATGATTCCAAGTGAAACTAATAAATGCAATA
CTCCAAACACCTACAGCAAAACAAACACCAAAAAAAAAAATCAAAACTCAAGCTTTGAGTAGTAACAAAAACTGTTTTTTCAGGGAGTTG
CTAAAAGGTTAAGCACTCCTCACTTCCAACACTTAGTTATAATAAGTTCGAGTCACCAAGGAAGCAAAAACGGTGGGAGCTCCCACGAAA
GGGGTATACAAAAAAGCTAAAAAAGTAATCTTTTCCTCCATGAACTATAATATAGGCAAAACTGTTTTCCAAATTGATTAGTCAAACACG
AAATACTACTCTCCAAAAGTACTTTTTAGAAAGCACCTAACAAAAAGAATATTTTCCAAAAAAAATTGTGGCCAACAAAATTTCAC
Reverse sequence
CTGGGAAGATACTTAGAAAGGAGTTAAGGAACATATTAACTTCCAAATTATAGAGCCTCTTCATCAACTGTTGAGCTGTGAAGCTGCCTA
ACAATGTTCGTTAACCGGCGATACACAGAAGAAATCAGTTATAGATTAAGATACTTTTTTTTGTGTTTCCTTATAATAGATGCAAAAGCA
CCAGTTACCTGGTAATATGTACAATTTTTTTATCAACCTTGTGATTTTAGCAGCTCTGGTTGCCATCTATAGCTGCTAAAACGTATCGAA
TAATCCCTTCGTTCAGTATATTGATCTCCTGATATTTTGCTGAAATTGAGAGCAATTTTTCTTTTGCCTCTCAAAGTGAAAAATTAGAAT
CTGGCTCCCCACATATTTTGGTAAGCCTTGAAGGAACTTGTAGCTTGTTTGACAAAGTTTTGGGGAAGTTAAAAAGTGTTTAATTTTTTT
CTAAAAATGTGCTTATATTATTAAAAGTGTTTTTCGAATTGA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1446341.2e-94174 (32.5% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39976)
Chromosome
8
Position
41.80 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7938)
Chromosome
8
Position
50.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG282 was used as an overgo probe on plate 12 [well E1]

Plausible BAC Matches:   P011I05,   P307D15,   P172P19,   P266I06,   P253P19,   P248I17,   P288A09,   P020I13

 Overgo Sequences

A sequence
CAGGGAGTTGCTAAAAGGTTAAGC
B sequence
GTTGGAAGTGAGGAGTGCTTAACC
AB sequence
CAGGGAGTTGCTAAAAGGTTAAGCACTCCT
Marker sequence
GGGAGACAGCTTGCATGCCTGCAGCCTTAGGAACAACGGAGTCAAGAATC
GTTAGAACAGCAAATGTGCAAAACATTCCAAATAGAGCACTTGGGAACTT
AATAGCAGCTTCCACAAATGCTTTCTTTAACAATTTATCCATAGCCAGTA
TGATTCCAAGTGAAACTAATAAATGCAATACTCCAAACACCTACAGCAAA
ACAAACACCAAAAAAAAAAATCAAAACTCAAGCTTTGAGTAGTAACAAAA
ACTGTTTTTTCAGGGAGTTGCTAAAAGGTTAAGCACTCCTCACTTCCAAC
ACTTAGTTATAATAAGTTCGAGTCACCAAGGAAGCAAAAACGGTGGGAGC
TCCCACGAAAGGGGTATACAAAAAAGCTAAAAAAGTAATCTTTTCCTCCA
TGAACTATAATATAGGCAAAACTGTTTTCCAAATTGATTAGTCAAACACG
AAATACTACTCTCCAAAAGTACTTTTTAGAAAGCACCTAACAAAAAGAAT
ATTTTCCAAAAAAAATTGTGGCCAACAAAATTTCAC
Genomic location of TG282  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D67 marker 67
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)