SGN Marker C2_At1g25580

SGN-M6707
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310417 (SGN)
130068 (CGN)
---
Lycopersicon CombinedSingleSGN-U227073---
Solanum tuberosumSingleSGN-U252506---
ArabidopsisSingleAt1g25580 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46571)
Chromosome
10
Position
76.30 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46433)
Chromosome
12
Position
73.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38137)
Chromosome
5
Position
43.60 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39425
Forward primer (5'-3')
ATTCCAACTGTTAATGAGGATGATGG
Accessions and product sizes
Solanum pennellii TA56
475
Solanum lycopersicum TA209
475
Approximate temperature
55°C
Reverse primer (5'-3')
AAGATAACAGGTTTTGTGCGACCAGTC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
475
Solanum pennellii TA56
400
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25112)
Chromosome
1
Position
9.00 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g25580  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6707 marker 6707
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)