SGN Marker C2_At1g26090

SGN-M6708
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle299306 (SGN)
120524 (CGN)
---
Solanum tuberosumSingleSGN-U264594---
ArabidopsisSingleAt1g26090 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25113)
Chromosome
1
Position
9.02 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41060
Forward primer (5'-3')
ACTGAAGCAAGCAGATGCTCGTC
Accessions and product sizes
Solanum lycopersicum TA209
1100
Solanum pennellii TA56
1100
Approximate temperature
55°C
Reverse primer (5'-3')
AGGAAGCACTCCAAGCTCTTCTCC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
850
Solanum pennellii TA56
600
Mg+2 concentration
1.5mM
   Enzymes
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g26090  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6708 marker 6708
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)