SGN Marker C2_At1g26520

SGN-M6711
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310751 (SGN)
127140 (CGN)
---
Lycopersicon CombinedSingleSGN-U230107---
Solanum tuberosumSingleSGN-U254853---
ArabidopsisSingleAt1g26520 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49206)
Chromosome
5
Position
5.70 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47137)
Chromosome
5
Position
68.00 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46572)
Chromosome
10
Position
60.90 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46434)
Chromosome
12
Position
65.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Eggplant-COSII   
Map version
63 (location: 42176)
Chromosome
10
Position
73.40 cM
Confidence
F(LOD3)
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43740
Forward primer (5'-3')
ACTGTGAAGCATAGTTTGGTTCAAGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTTGTGTTATAGGCAAGTTGTCAGAT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41316)
Chromosome
11
Position
25.70 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43292
Forward primer (5'-3')
ACTGTGAAGCATAGTTTGGTTCAAGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACATCTGATTCCAGCTGATCATCCAAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38138)
Chromosome
5
Position
56.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39426
Forward primer (5'-3')
ACTGTGAAGCATAGTTTGGTTCAAGC
Accessions and product sizes
Solanum lycopersicum TA209
320
Solanum pennellii TA56
320
Approximate temperature
55°C
Reverse primer (5'-3')
ACATCTGATTCCAGCTGATCATCCAAC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
325
Solanum pennellii TA56
200
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25116)
Chromosome
1
Position
9.16 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10101
Forward primer (5'-3')
ACTGTGAAGCATAGTTTGGTTCAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACATCTGATTCCAGCTGATCATCCAAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 10102
Forward primer (5'-3')
ACTGTGAAGCATAGTTTGGTTCAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACATCTGATTCCAGCTGATCATCCAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 10103
Forward primer (5'-3')
ACTGTGAAGCATAGTTTGGTTCAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACATCTGATTCCAGCTGATCATCCAAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 32207
Forward primer (5'-3')
ACTGTGAAGCATAGTTTGGTTCAAGC
Digested band sizes (using HincII)
Solanum lycopersicum LA925: 700
Solanum pennellii LA716: 310+390
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACATCTGATTCCAGCTGATCATCCAAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: HincII
All possible enzymes for lycopersicum and pimpinellifolium: AflIII,BspLU11I/PciI
  
Accessions and product sizes
Solanum pennellii LA716: 700
Solanum lycopersicum LA925: 700
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g26520F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At1g26520  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6711 marker 6711
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)