SGN Marker C2_At1g26670

SGN-M6715
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303498 (SGN)
119533 (CGN)
---
Lycopersicon CombinedSingleSGN-U217637---
ArabidopsisSingleAt1g26670 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49207)
Chromosome
5
Position
6.16 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47138)
Chromosome
5
Position
73.90 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46573)
Chromosome
10
Position
67.20 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38140)
Chromosome
5
Position
59.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39428
Forward primer (5'-3')
AAAATGGATCTCGAGGCAAGAAG
Accessions and product sizes
Solanum lycopersicum TA209
425
Solanum pennellii TA56
425
Approximate temperature
55°C
Reverse primer (5'-3')
AAGCGTTCCCTTTGACTTGCAGAAG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
425
Solanum lycopersicum TA209
375
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25120)
Chromosome
1
Position
9.22 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g26670  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6715 marker 6715
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)