SGN Marker C2_At1g26945

SGN-M6718
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U200675---
Lycopersicon CombinedSingleSGN-U225277---
ArabidopsisSingleAt1g26945 on TAIR---
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42177)
Chromosome
10
Position
68.60 cM
Confidence
I
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43741
Forward primer (5'-3')
ATCGCTGATCTTGTTTCCAAGTTGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AATAGCAGCTTGAGCACTATCACTATC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38143)
Chromosome
5
Position
17.70 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39429
Forward primer (5'-3')
ATCGCTGATCTTGTTTCCAAGTTGC
Accessions and product sizes
Solanum pennellii TA56
200
Solanum lycopersicum TA209
200
Approximate temperature
55°C
Reverse primer (5'-3')
AATAGCAGCTTGAGCACTATCACTATC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25123)
Chromosome
1
Position
9.35 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10110
Forward primer (5'-3')
ATCGCTGATCTTGTTTCCAAGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATAGCAGCTTGAGCACTATCACTATC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 10111
Forward primer (5'-3')
ATCGCTGATCTTGTTTCCAAGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATAGCAGCTTGAGCACTATCACTATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 10112
Forward primer (5'-3')
ATCGCTGATCTTGTTTCCAAGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATAGCAGCTTGAGCACTATCACTATC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 10113
Forward primer (5'-3')
ATCGCTGATCTTGTTTCCAAGTTGC
Digested band sizes (using amplicon difference)
Solanum pennellii LA716: 950
Solanum lycopersicum LA925: 1200
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATAGCAGCTTGAGCACTATCACTATC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Solanum pennellii LA716: 950
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At1g26945  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6718 marker 6718
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)