SGN Marker C2_At1g27450

SGN-M6723
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U196188---
Lycopersicon CombinedMultipleSGN-U213329---
Solanum tuberosumSingleSGN-U244275---
ArabidopsisSingleAt1g27450 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25128)
Chromosome
1
Position
9.53 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41069
Forward primer (5'-3')
TACTTGATCCAAAGGCGTTTAAGG
Accessions and product sizes
Solanum lycopersicum TA209
2000
Solanum pennellii TA56
2000
Approximate temperature
55°C
Reverse primer (5'-3')
AATGGGAGGACCAAAGATAAAACC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 10118
Forward primer (5'-3')
TACTTGATCCAAAGGCGTTTAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATGGGAGGACCAAAGATAAAACC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 10119
Forward primer (5'-3')
TACTTGATCCAAAGGCGTTTAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATGGGAGGACCAAAGATAAAACC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 32208
Forward primer (5'-3')
TACTTGATCCAAAGGCGTTTAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATGGGAGGACCAAAGATAAAACC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 2000
Approximate temperature
53°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At1g27450  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6723 marker 6723
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)