SGN Marker CT265

SGN-M673

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1300
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
not available
Reverse sequence
TTTTTTTTTGCTAGGAAGGGTCAGAGATTTTCTCTTCCCGATGAGAGGCGGCCTCCTGTGGAGTTCATTGCCTTCTCCAATTGCTTGCTT
GGTTGGACCGGGGGTGCCGATGCTTTGACAAGGGGGATTTTTACAGGCCACCTTTTGCCCCTATAATGCCTCGAGCTACTTTCCTGGAGT
ATGGGAATGATCAAGCTTTTTTAGAATTAATTCCCAGTGGTTGAATAGCTGCTGTATTTGTCGAACCTCTCC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1472771.1e-43228 (90.5% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53469)
Chromosome
8
Position
69.11 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Sun1642 x LA1589   
Map version
85 (location: 43650)
Chromosome
8
Position
70.90 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43509)
Chromosome
8
Position
52.20 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43050)
Chromosome
8
Position
69.40 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Eggplant-COSII   
Map version
63 (location: 42342)
Chromosome
8
Position
102.90 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40753)
Chromosome
8
Position
75.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39042)
Chromosome
8
Position
68.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 9780)
Chromosome
8
Position
61.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 9782)
Chromosome
8
Position
81.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9781)
Chromosome
8
Position
79.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 9786)
Chromosome
8
Position
77.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
CT265 was used as an overgo probe on plate 11 [well F11]

Plausible BAC Matches:   P168A03,   P004B22

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CTCCTGTGGAGTTCATTGCCTTCT
B sequence
CCAAGCAAGCAATTGGAGAAGGCA
AB sequence
CTCCTGTGGAGTTCATTGCCTTCTCCAATT
Marker sequence
TTTTTTTTTGCTAGGAAGGGTCAGAGATTTTCTCTTCCCGATGAGAGGCG
GCCTCCTGTGGAGTTCATTGCCTTCTCCAATTGCTTGCTTGGTTGGACCG
GGGGTGCCGATGCTTTGACAAGGGGGATTTTTACAGGCCACCTTTTGCCC
CTATAATGCCTCGAGCTACTTTCCTGGAGTATGGGAATGATCAAGCTTTT
TTAGAATTAATTCCCAGTGGTTGAATAGCTGCTGTATTTGTCGAACCTCT
CC
Genomic location of CT265  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D673 marker 673
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)