SGN Marker C2_At1g29520

SGN-M6743
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303762 (SGN)
120764 (CGN)
---
Lycopersicon CombinedSingleSGN-U223436---
ArabidopsisSingleAt1g29520 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38155)
Chromosome
3
Position
52.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39438
Forward primer (5'-3')
TTGGGCTATGAACTTTGCCATTG
Accessions and product sizes
Solanum pennellii TA56
390
Solanum lycopersicum TA209
390
Approximate temperature
53°C
Reverse primer (5'-3')
AAAGAATCCAGTGGCAGCATTTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25148)
Chromosome
1
Position
10.32 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10137
Forward primer (5'-3')
TTGGGCTATGAACTTTGCCATTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAAGAATCCAGTGGCAGCATTTCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 330
Approximate temperature
55°C
  
PCR data   Exp. ID 10138
Forward primer (5'-3')
TTGGGCTATGAACTTTGCCATTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAAGAATCCAGTGGCAGCATTTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 330
Approximate temperature
55°C
  
PCR data   Exp. ID 10139
Forward primer (5'-3')
TTGGGCTATGAACTTTGCCATTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAAGAATCCAGTGGCAGCATTTCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 330
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g29520F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At1g29520  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6743 marker 6743
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)