SGN Marker C2_At1g29700

SGN-M6744
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303446 (SGN)
120638 (CGN)
---
Lycopersicon CombinedSingleSGN-U218047---
Solanum tuberosumMultipleSGN-U245715---
ArabidopsisSingleAt1g29700 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25149)
Chromosome
1
Position
10.39 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41074
Forward primer (5'-3')
AATTCCTTGGTTATATGATGCTGC
Accessions and product sizes
Solanum pennellii TA56
150
Solanum lycopersicum TA209
150
Approximate temperature
55°C
Reverse primer (5'-3')
ATGACAATGATCATCAAGGCTTTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 10140
Forward primer (5'-3')
AATTCCTTGGTTATATGATGCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGACAATGATCATCAAGGCTTTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 10141
Forward primer (5'-3')
AATTCCTTGGTTATATGATGCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGACAATGATCATCAAGGCTTTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 10142
Forward primer (5'-3')
AATTCCTTGGTTATATGATGCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGACAATGATCATCAAGGCTTTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 150
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g29700  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6744 marker 6744
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)