SGN Marker C2_At1g30000

SGN-M6750
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle306511 (SGN)
127181 (CGN)
---
Capsicum annuumSingleSGN-U204412---
Lycopersicon CombinedSingleSGN-U239414---
Solanum tuberosumSingleSGN-U257933---
ArabidopsisSingleAt1g30000 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46576)
Chromosome
2
Position
3.60 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38159)
Chromosome
2
Position
38.30 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39441
Forward primer (5'-3')
TCTGCACATCCTGCCCCTGATGG
Accessions and product sizes
Solanum lycopersicum TA209
375
Solanum pennellii TA56
375
Approximate temperature
60°C
Reverse primer (5'-3')
TGCGAACAAGAAGATGCCTGACACC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
300
Solanum pennellii TA56
200
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25155)
Chromosome
1
Position
10.51 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g30000  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6750 marker 6750
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)