SGN Marker C2_At1g30110

SGN-M6751
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle307553 (SGN)
126986 (CGN)
---
Capsicum annuumSingleSGN-U204070---
Solanum tuberosumSingleSGN-U267870---
ArabidopsisSingleAt1g30110 on TAIR---
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42180)
Chromosome
10
Position
0.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43744
Forward primer (5'-3')
AATGTACCCGGAGCATGGCAAATG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGGGAAGTCATACGTCAACCATTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38160)
Chromosome
5
Position
25.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39442
Forward primer (5'-3')
AATGTACCCGGAGCATGGCAAATG
Accessions and product sizes
Solanum pennellii TA56
625
Solanum lycopersicum TA209
625
Approximate temperature
55°C
Reverse primer (5'-3')
TGGGAAGTCATACGTCAACCATTG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
625
Solanum pennellii TA56
350
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25156)
Chromosome
1
Position
10.58 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g30110  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6751 marker 6751
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)