SGN Marker C2_At1g31970

SGN-M6771
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302024 (SGN)
122537 (CGN)
---
Lycopersicon CombinedSingleSGN-U221029---
Solanum tuberosumMultipleSGN-U250973---
ArabidopsisSingleAt1g31970 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25177)
Chromosome
1
Position
11.48 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41080
Forward primer (5'-3')
TTATTGGAACCCCTGGTCGTTTG
Accessions and product sizes
Solanum pennellii TA56
1000
Solanum lycopersicum TA209
1000
Approximate temperature
50°C
Reverse primer (5'-3')
ATCAAGCATGCGATCAGCTTCATC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 10165
Forward primer (5'-3')
TTATTGGAACCCCTGGTCGTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCAAGCATGCGATCAGCTTCATC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Approximate temperature
50°C
  
PCR data   Exp. ID 10166
Forward primer (5'-3')
TTATTGGAACCCCTGGTCGTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCAAGCATGCGATCAGCTTCATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Approximate temperature
50°C
  
PCR data   Exp. ID 10167
Forward primer (5'-3')
TTATTGGAACCCCTGGTCGTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCAAGCATGCGATCAGCTTCATC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1000
Approximate temperature
50°C
  
PCR data   Exp. ID 12575
Forward primer (5'-3')
TTATTGGAACCCCTGGTCGTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCAAGCATGCGATCAGCTTCATC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 12576
Forward primer (5'-3')
TTATTGGAACCCCTGGTCGTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCAAGCATGCGATCAGCTTCATC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 12577
Forward primer (5'-3')
TTATTGGAACCCCTGGTCGTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCAAGCATGCGATCAGCTTCATC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 12578
Forward primer (5'-3')
TTATTGGAACCCCTGGTCGTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCAAGCATGCGATCAGCTTCATC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 12579
Forward primer (5'-3')
TTATTGGAACCCCTGGTCGTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCAAGCATGCGATCAGCTTCATC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 12580
Forward primer (5'-3')
TTATTGGAACCCCTGGTCGTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCAAGCATGCGATCAGCTTCATC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 12581
Forward primer (5'-3')
TTATTGGAACCCCTGGTCGTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCAAGCATGCGATCAGCTTCATC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 12582
Forward primer (5'-3')
TTATTGGAACCCCTGGTCGTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCAAGCATGCGATCAGCTTCATC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 12583
Forward primer (5'-3')
TTATTGGAACCCCTGGTCGTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCAAGCATGCGATCAGCTTCATC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 12584
Forward primer (5'-3')
TTATTGGAACCCCTGGTCGTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCAAGCATGCGATCAGCTTCATC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 32597
Forward primer (5'-3')
TTATTGGAACCCCTGGTCGTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCAAGCATGCGATCAGCTTCATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 32749
Forward primer (5'-3')
TTATTGGAACCCCTGGTCGTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCAAGCATGCGATCAGCTTCATC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 32750
Forward primer (5'-3')
TTATTGGAACCCCTGGTCGTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCAAGCATGCGATCAGCTTCATC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 32751
Forward primer (5'-3')
TTATTGGAACCCCTGGTCGTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCAAGCATGCGATCAGCTTCATC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 32752
Forward primer (5'-3')
TTATTGGAACCCCTGGTCGTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCAAGCATGCGATCAGCTTCATC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 32753
Forward primer (5'-3')
TTATTGGAACCCCTGGTCGTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCAAGCATGCGATCAGCTTCATC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 600
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g31970  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6771 marker 6771
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)