SGN Marker C2_At1g32070

SGN-M6772
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U199935---
Lycopersicon CombinedSingleSGN-U220897---
Solanum tuberosumSingleSGN-U257017---
ArabidopsisSingleAt1g32070 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38167)
Chromosome
10
Position
39.40 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39449
Forward primer (5'-3')
TTGCATTCTAGGAAATTCTCATCAGG
Accessions and product sizes
Solanum lycopersicum TA209
80
Solanum pennellii TA56
80
Approximate temperature
55°C
Reverse primer (5'-3')
TTGCACGGGCCATGCCTATC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25178)
Chromosome
1
Position
11.54 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10168
Forward primer (5'-3')
TTGCATTCTAGGAAATTCTCATCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCACGGGCCATGCCTATC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 10169
Forward primer (5'-3')
TTGCATTCTAGGAAATTCTCATCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCACGGGCCATGCCTATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 10170
Forward primer (5'-3')
TTGCATTCTAGGAAATTCTCATCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCACGGGCCATGCCTATC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12585
Forward primer (5'-3')
TTGCATTCTAGGAAATTCTCATCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCACGGGCCATGCCTATC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 12586
Forward primer (5'-3')
TTGCATTCTAGGAAATTCTCATCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCACGGGCCATGCCTATC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 12587
Forward primer (5'-3')
TTGCATTCTAGGAAATTCTCATCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCACGGGCCATGCCTATC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 12588
Forward primer (5'-3')
TTGCATTCTAGGAAATTCTCATCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCACGGGCCATGCCTATC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 12589
Forward primer (5'-3')
TTGCATTCTAGGAAATTCTCATCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCACGGGCCATGCCTATC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 12590
Forward primer (5'-3')
TTGCATTCTAGGAAATTCTCATCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCACGGGCCATGCCTATC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 12591
Forward primer (5'-3')
TTGCATTCTAGGAAATTCTCATCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCACGGGCCATGCCTATC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 12592
Forward primer (5'-3')
TTGCATTCTAGGAAATTCTCATCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCACGGGCCATGCCTATC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 12593
Forward primer (5'-3')
TTGCATTCTAGGAAATTCTCATCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCACGGGCCATGCCTATC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12594
Forward primer (5'-3')
TTGCATTCTAGGAAATTCTCATCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCACGGGCCATGCCTATC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 12595
Forward primer (5'-3')
TTGCATTCTAGGAAATTCTCATCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCACGGGCCATGCCTATC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 12596
Forward primer (5'-3')
TTGCATTCTAGGAAATTCTCATCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCACGGGCCATGCCTATC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 32754
Forward primer (5'-3')
TTGCATTCTAGGAAATTCTCATCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCACGGGCCATGCCTATC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 32755
Forward primer (5'-3')
TTGCATTCTAGGAAATTCTCATCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCACGGGCCATGCCTATC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 32756
Forward primer (5'-3')
TTGCATTCTAGGAAATTCTCATCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCACGGGCCATGCCTATC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 32757
Forward primer (5'-3')
TTGCATTCTAGGAAATTCTCATCAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCACGGGCCATGCCTATC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 10171
Forward primer (5'-3')
TTGCATTCTAGGAAATTCTCATCAGG
Digested band sizes (using DpnII)
Solanum pennellii LA716: 250
Solanum lycopersicum LA925: 200
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCACGGGCCATGCCTATC
Enzymes
All possible enzymes for pennellii and and lycopersicum: DpnII
  
Accessions and product sizes
Solanum pennellii LA716: 250
Solanum lycopersicum LA925: 250
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Forward sequence for 68, AB1 chromatogram - [View]
Forward sequence for 68, PDF chromatogram
Forward sequence for 68, plain text
1g32070Fhab-1g32070F.ab1, AB1 chromatogram - [View]
1g32070Fhab-1g32070F.pdf, PDF chromatogram
1g32070Fhab-1g32070F.txt, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At1g32070  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6772 marker 6772
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)