SGN Marker C2_At1g32460

SGN-M6779
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle307659 (SGN)
125986 (CGN)
---
Lycopersicon CombinedMultipleSGN-U227721---
Solanum tuberosumSingleSGN-U249188---
ArabidopsisSingleAt1g32460 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25185)
Chromosome
1
Position
11.74 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41083
Forward primer (5'-3')
TGAAGAAGTGACTCGGGAGTCACTAAT
Accessions and product sizes
Solanum pennellii TA56
500
Solanum lycopersicum TA209
500
Approximate temperature
55°C
Reverse primer (5'-3')
AGATTCAACAGAAGGATCTATCTCTGGT
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
325
Solanum lycopersicum TA209
325
Mg+2 concentration
1.5mM
   Enzymes
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g32460  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6779 marker 6779
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)