SGN Marker C2_At1g34370

SGN-M6791
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304471 (SGN)
124614 (CGN)
---
Capsicum annuumSingleSGN-U205148---
ArabidopsisSingleAt1g34370 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38173)
Chromosome
4
Position
63.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39454
Forward primer (5'-3')
TCCGACGAAATCACCTCCGC
Accessions and product sizes
Solanum lycopersicum TA209
900
Solanum pennellii TA56
900
Approximate temperature
55°C
Reverse primer (5'-3')
TGTTTTGTACTGGTTCCCATGAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25197)
Chromosome
1
Position
12.55 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10177
Forward primer (5'-3')
TCCGACGAAATCACCTCCGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTTTGTACTGGTTCCCATGAGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 10178
Forward primer (5'-3')
TCCGACGAAATCACCTCCGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTTTGTACTGGTTCCCATGAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 10179
Forward primer (5'-3')
TCCGACGAAATCACCTCCGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTTTGTACTGGTTCCCATGAGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 32212
Forward primer (5'-3')
TCCGACGAAATCACCTCCGC
Digested band sizes (using HaeIII)
Solanum lycopersicum LA925: 280
Solanum pennellii LA716: 350
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTTTGTACTGGTTCCCATGAGC
Enzymes
All possible enzymes for lycopersicum and pimpinellifolium: BglI,BsiEI,BstUI,BtgI,SacII
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Solanum pennellii LA716: 350
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g34370F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At1g34370  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6791 marker 6791
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)