SGN Marker C2_At1g35720

SGN-M6793
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle299414 (SGN)
123368 (CGN)
---
Solanum tuberosumSingleSGN-U243390---
ArabidopsisSingleAt1g35720 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38174)
Chromosome
4
Position
62.20 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39455
Forward primer (5'-3')
ATTCTGGCTCATAGGAATGCAGCAC
Accessions and product sizes
Solanum lycopersicum TA209
250
Solanum pennellii TA56
250
Approximate temperature
53°C
Reverse primer (5'-3')
ATAAGAGGAACCAAAAGCTTACGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25199)
Chromosome
1
Position
13.23 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10180
Forward primer (5'-3')
ATTCTGGCTCATAGGAATGCAGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATAAGAGGAACCAAAAGCTTACGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 10181
Forward primer (5'-3')
ATTCTGGCTCATAGGAATGCAGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATAAGAGGAACCAAAAGCTTACGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 10182
Forward primer (5'-3')
ATTCTGGCTCATAGGAATGCAGCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATAAGAGGAACCAAAAGCTTACGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 12184
Forward primer (5'-3')
TCTGGACTTTGAGTCCTGCTGAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTGTCTCCAGCAATTGCACGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 12185
Forward primer (5'-3')
TCTGGACTTTGAGTCCTGCTGAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTGTCTCCAGCAATTGCACGG
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12186
Forward primer (5'-3')
TCTGGACTTTGAGTCCTGCTGAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTGTCTCCAGCAATTGCACGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12187
Forward primer (5'-3')
TCTGGACTTTGAGTCCTGCTGAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTGTCTCCAGCAATTGCACGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12188
Forward primer (5'-3')
TCTGGACTTTGAGTCCTGCTGAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTGTCTCCAGCAATTGCACGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12189
Forward primer (5'-3')
TCTGGACTTTGAGTCCTGCTGAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTGTCTCCAGCAATTGCACGG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 220+1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12190
Forward primer (5'-3')
TCTGGACTTTGAGTCCTGCTGAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTGTCTCCAGCAATTGCACGG
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12191
Forward primer (5'-3')
TCTGGACTTTGAGTCCTGCTGAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTGTCTCCAGCAATTGCACGG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12192
Forward primer (5'-3')
TCTGGACTTTGAGTCCTGCTGAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTGTCTCCAGCAATTGCACGG
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 400+1300
Approximate temperature
55°C
  
PCR data   Exp. ID 33314
Forward primer (5'-3')
TCTGGACTTTGAGTCCTGCTGAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTGTCTCCAGCAATTGCACGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 33315
Forward primer (5'-3')
TCTGGACTTTGAGTCCTGCTGAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTGTCTCCAGCAATTGCACGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 33316
Forward primer (5'-3')
TCTGGACTTTGAGTCCTGCTGAGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTGTCTCCAGCAATTGCACGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 10183
Forward primer (5'-3')
ATTCTGGCTCATAGGAATGCAGCAC
Digested band sizes (using TaqI)
Solanum pennellii LA716: 500+850
Solanum lycopersicum LA925: 350+500
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATAAGAGGAACCAAAAGCTTACGG
Enzymes
All possible enzymes for pennellii and and lycopersicum: MspI, TaqI
  
Accessions and product sizes
Solanum lycopersicum LA925: 1350
Solanum pennellii LA716: 1350
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At1g35720  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6793 marker 6793
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)