SGN Marker C2_At1g44835

SGN-M6808
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U197234---
Lycopersicon CombinedMultipleSGN-U215517---
Solanum tuberosumSingleSGN-U255224---
ArabidopsisSingleAt1g44835 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38182)
Chromosome
6
Position
38.30 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39463
Forward primer (5'-3')
AGGAAAGGATCAACCTCCTGATCTAGC
Accessions and product sizes
Solanum lycopersicum TA209
350
Solanum pennellii TA56
350
Approximate temperature
55°C
Reverse primer (5'-3')
TCTACATATTTTTCAGGATCAGCAAACG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
350
Solanum pennellii TA56
175
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25216)
Chromosome
1
Position
16.94 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g44835  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6808 marker 6808
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)