SGN Marker C2_At1g47830

SGN-M6816
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U201572---
Lycopersicon CombinedSingleSGN-U221287---
Solanum tuberosumSingleSGN-U251046---
ArabidopsisSingleAt1g47830 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49212)
Chromosome
4
Position
62.99 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47143)
Chromosome
4
Position
120.30 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42183)
Chromosome
4
Position
117.00 cM
Confidence
F(LOD3)
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43747
Forward primer (5'-3')
TTGTGAATAGAGATCCCAAATTCACC
Accessions and product sizes
Approximate temperature
53°C
Reverse primer (5'-3')
ATAACAATTTCATACTCATCCATAACG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38184)
Chromosome
4
Position
129.50 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39465
Forward primer (5'-3')
TTGTGAATAGAGATCCCAAATTCACC
Accessions and product sizes
Solanum pennellii TA56
900
Solanum lycopersicum TA209
1000
Approximate temperature
55°C
Reverse primer (5'-3')
TCCTGCATATCTTCTGTATATTACCTTG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
900
Solanum lycopersicum TA209
1000
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25224)
Chromosome
1
Position
17.62 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10221
Forward primer (5'-3')
TTGTGAATAGAGATCCCAAATTCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTGCATATCTTCTGTATATTACCTTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 10222
Forward primer (5'-3')
TTGTGAATAGAGATCCCAAATTCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTGCATATCTTCTGTATATTACCTTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 10223
Forward primer (5'-3')
TTGTGAATAGAGATCCCAAATTCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTGCATATCTTCTGTATATTACCTTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 12661
Forward primer (5'-3')
TTGTGAATAGAGATCCCAAATTCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTGCATATCTTCTGTATATTACCTTG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12662
Forward primer (5'-3')
TTGTGAATAGAGATCCCAAATTCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTGCATATCTTCTGTATATTACCTTG
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 12663
Forward primer (5'-3')
TTGTGAATAGAGATCCCAAATTCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTGCATATCTTCTGTATATTACCTTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 12664
Forward primer (5'-3')
TTGTGAATAGAGATCCCAAATTCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTGCATATCTTCTGTATATTACCTTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12665
Forward primer (5'-3')
TTGTGAATAGAGATCCCAAATTCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTGCATATCTTCTGTATATTACCTTG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 12666
Forward primer (5'-3')
TTGTGAATAGAGATCCCAAATTCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTGCATATCTTCTGTATATTACCTTG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1700
Approximate temperature
55°C
  
PCR data   Exp. ID 12667
Forward primer (5'-3')
TTGTGAATAGAGATCCCAAATTCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTGCATATCTTCTGTATATTACCTTG
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 1950
Approximate temperature
55°C
  
PCR data   Exp. ID 32778
Forward primer (5'-3')
TTGTGAATAGAGATCCCAAATTCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTGCATATCTTCTGTATATTACCTTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 32779
Forward primer (5'-3')
TTGTGAATAGAGATCCCAAATTCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTGCATATCTTCTGTATATTACCTTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32780
Forward primer (5'-3')
TTGTGAATAGAGATCCCAAATTCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTGCATATCTTCTGTATATTACCTTG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 10224
Forward primer (5'-3')
TTGTGAATAGAGATCCCAAATTCACC
Digested band sizes (using AluI)
Solanum lycopersicum LA925: 600
Solanum pennellii LA716: 850
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTGCATATCTTCTGTATATTACCTTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, DraI
  
Accessions and product sizes
Solanum pennellii LA716: 1350
Solanum lycopersicum LA925: 1350
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At1g47830  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6816 marker 6816
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)