SGN Marker C2_At1g48050

SGN-M6818
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle306480 (SGN)
127608 (CGN)
---
Lycopersicon CombinedMultipleSGN-U217517---
Solanum tuberosumSingleSGN-U250066---
ArabidopsisSingleAt1g48050 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38185)
Chromosome
1
Position
58.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39466
Forward primer (5'-3')
TGAAAGAGGAAATAGGAGGATATGAAC
Accessions and product sizes
Solanum lycopersicum TA209
1600
Solanum pennellii TA56
1600
Approximate temperature
55°C
Reverse primer (5'-3')
ATCGTGACTGGCGATATATTACGAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25226)
Chromosome
1
Position
17.73 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10225
Forward primer (5'-3')
TGAAAGAGGAAATAGGAGGATATGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCGTGACTGGCGATATATTACGAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 920
Approximate temperature
55°C
  
PCR data   Exp. ID 10226
Forward primer (5'-3')
TGAAAGAGGAAATAGGAGGATATGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCGTGACTGGCGATATATTACGAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 920
Approximate temperature
55°C
  
PCR data   Exp. ID 10227
Forward primer (5'-3')
TGAAAGAGGAAATAGGAGGATATGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCGTGACTGGCGATATATTACGAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 32214
Forward primer (5'-3')
TGAAAGAGGAAATAGGAGGATATGAAC
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 920
Solanum pennellii LA716: 750
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCGTGACTGGCGATATATTACGAG
Enzymes
All possible enzymes for pennellii and and lycopersicum: ApaLI,CfoI/HhaI,TaqI,Tsp509I
  
Accessions and product sizes
Solanum pennellii LA716: 920
Solanum lycopersicum LA925: 920
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g48050F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At1g48050  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6818 marker 6818
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)