SGN Marker C2_At1g52590

SGN-M6854
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304085 (SGN)
123919 (CGN)
---
Lycopersicon CombinedSingleSGN-U222865---
Solanum tuberosumSingleSGN-U263825---
ArabidopsisSingleAt1g52590 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38198)
Chromosome
3
Position
128.30 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39476
Forward primer (5'-3')
TGTGCAACCTGTGTAATGGAGGTGTG
Accessions and product sizes
Solanum pennellii TA56
1500
Solanum lycopersicum TA209
1500
Approximate temperature
55°C
Reverse primer (5'-3')
TGAGGGAAAGGCAAGTTAATGTACTC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
600
Solanum pennellii TA56
900
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25263)
Chromosome
1
Position
19.59 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10257
Forward primer (5'-3')
TGTGCAACCTGTGTAATGGAGGTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGGGAAAGGCAAGTTAATGTACTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1050
Approximate temperature
55°C
  
PCR data   Exp. ID 10258
Forward primer (5'-3')
TGTGCAACCTGTGTAATGGAGGTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGGGAAAGGCAAGTTAATGTACTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1050
Approximate temperature
55°C
  
PCR data   Exp. ID 10259
Forward primer (5'-3')
TGTGCAACCTGTGTAATGGAGGTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGGGAAAGGCAAGTTAATGTACTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1050
Approximate temperature
55°C
  
PCR data   Exp. ID 32216
Forward primer (5'-3')
TGTGCAACCTGTGTAATGGAGGTGTG
Digested band sizes (using TaqI)
Solanum pennellii LA716: 400+650
Solanum lycopersicum LA925: 1050
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGGGAAAGGCAAGTTAATGTACTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: ApaI,ApoI,BanII,EcoRI,SalI,TaqI
  
Accessions and product sizes
Solanum pennellii LA716: 1050
Solanum lycopersicum LA925: 1050
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g52590F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text


Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g52590F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At1g52590  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6854 marker 6854
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)