SGN Marker C2_At1g52980

SGN-M6855
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302053 (SGN)
121609 (CGN)
---
Capsicum annuumSingleSGN-U197965---
Lycopersicon CombinedSingleSGN-U215221---
Solanum tuberosumMultipleSGN-U243536---
ArabidopsisSingleAt1g52980 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38199)
Chromosome
7
Position
68.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39477
Forward primer (5'-3')
AAAATTGCAAGCACAAACATATGG
Accessions and product sizes
Solanum lycopersicum TA209
250
Solanum pennellii TA56
250
Approximate temperature
55°C
Reverse primer (5'-3')
ATTCCCTAGAGAGCACTCTAAGCC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
250
Solanum lycopersicum TA209
100+190
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25264)
Chromosome
1
Position
19.74 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10260
Forward primer (5'-3')
AAAATTGCAAGCACAAACATATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCCCTAGAGAGCACTCTAAGCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 10261
Forward primer (5'-3')
AAAATTGCAAGCACAAACATATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCCCTAGAGAGCACTCTAAGCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 10262
Forward primer (5'-3')
AAAATTGCAAGCACAAACATATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCCCTAGAGAGCACTCTAAGCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12682
Forward primer (5'-3')
AAAATTGCAAGCACAAACATATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCCCTAGAGAGCACTCTAAGCC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12683
Forward primer (5'-3')
AAAATTGCAAGCACAAACATATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCCCTAGAGAGCACTCTAAGCC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12684
Forward primer (5'-3')
AAAATTGCAAGCACAAACATATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCCCTAGAGAGCACTCTAAGCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12685
Forward primer (5'-3')
AAAATTGCAAGCACAAACATATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCCCTAGAGAGCACTCTAAGCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12686
Forward primer (5'-3')
AAAATTGCAAGCACAAACATATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCCCTAGAGAGCACTCTAAGCC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12687
Forward primer (5'-3')
AAAATTGCAAGCACAAACATATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCCCTAGAGAGCACTCTAAGCC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12688
Forward primer (5'-3')
AAAATTGCAAGCACAAACATATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCCCTAGAGAGCACTCTAAGCC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 12689
Forward primer (5'-3')
AAAATTGCAAGCACAAACATATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCCCTAGAGAGCACTCTAAGCC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 12690
Forward primer (5'-3')
AAAATTGCAAGCACAAACATATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCCCTAGAGAGCACTCTAAGCC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 32600
Forward primer (5'-3')
AAAATTGCAAGCACAAACATATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCCCTAGAGAGCACTCTAAGCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 32789
Forward primer (5'-3')
AAAATTGCAAGCACAAACATATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCCCTAGAGAGCACTCTAAGCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 32790
Forward primer (5'-3')
AAAATTGCAAGCACAAACATATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCCCTAGAGAGCACTCTAAGCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 32791
Forward primer (5'-3')
AAAATTGCAAGCACAAACATATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCCCTAGAGAGCACTCTAAGCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 32792
Forward primer (5'-3')
AAAATTGCAAGCACAAACATATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCCCTAGAGAGCACTCTAAGCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 32793
Forward primer (5'-3')
AAAATTGCAAGCACAAACATATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCCCTAGAGAGCACTCTAAGCC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 10263
Forward primer (5'-3')
AAAATTGCAAGCACAAACATATGG
Digested band sizes (using HaeIII)
Solanum pennellii LA716: 250
Solanum lycopersicum LA925: 100+190
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTCCCTAGAGAGCACTCTAAGCC
Enzymes
All possible enzymes for pennellii and and lycopersicum: HaeIII
  
Accessions and product sizes
Solanum pennellii LA716: 250
Solanum lycopersicum LA925: 250
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At1g52980  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6855 marker 6855
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)