SGN Marker C2_At1g53000

SGN-M6856
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304055 (SGN)
124971 (CGN)
---
Capsicum annuumSingleSGN-U201101---
Lycopersicon CombinedSingleSGN-U216303---
Solanum tuberosumSingleSGN-U263773---
ArabidopsisSingleAt1g53000 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38200)
Chromosome
10
Position
7.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39478
Forward primer (5'-3')
AGATTCTCGGCAAGCCTATGATCC
Accessions and product sizes
Solanum lycopersicum TA209
350
Solanum pennellii TA56
350
Approximate temperature
55°C
Reverse primer (5'-3')
AAGCTTTGCCCTTTCCCATGTTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
300
Solanum lycopersicum TA209
350
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25265)
Chromosome
1
Position
19.75 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10264
Forward primer (5'-3')
AGATTCTCGGCAAGCCTATGATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTTTGCCCTTTCCCATGTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1800
Approximate temperature
55°C
  
PCR data   Exp. ID 10265
Forward primer (5'-3')
AGATTCTCGGCAAGCCTATGATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTTTGCCCTTTCCCATGTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1800
Approximate temperature
55°C
  
PCR data   Exp. ID 10266
Forward primer (5'-3')
AGATTCTCGGCAAGCCTATGATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTTTGCCCTTTCCCATGTTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1800
Approximate temperature
55°C
  
PCR data   Exp. ID 12691
Forward primer (5'-3')
AGATTCTCGGCAAGCCTATGATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTTTGCCCTTTCCCATGTTC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12692
Forward primer (5'-3')
AGATTCTCGGCAAGCCTATGATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTTTGCCCTTTCCCATGTTC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12693
Forward primer (5'-3')
AGATTCTCGGCAAGCCTATGATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTTTGCCCTTTCCCATGTTC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12694
Forward primer (5'-3')
AGATTCTCGGCAAGCCTATGATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTTTGCCCTTTCCCATGTTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12695
Forward primer (5'-3')
AGATTCTCGGCAAGCCTATGATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTTTGCCCTTTCCCATGTTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1100+350
Approximate temperature
55°C
  
PCR data   Exp. ID 12696
Forward primer (5'-3')
AGATTCTCGGCAAGCCTATGATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTTTGCCCTTTCCCATGTTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12697
Forward primer (5'-3')
AGATTCTCGGCAAGCCTATGATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTTTGCCCTTTCCCATGTTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12698
Forward primer (5'-3')
AGATTCTCGGCAAGCCTATGATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTTTGCCCTTTCCCATGTTC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12699
Forward primer (5'-3')
AGATTCTCGGCAAGCCTATGATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTTTGCCCTTTCCCATGTTC
Enzymes
  
Accessions and product sizes
Physalis TA1367: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12700
Forward primer (5'-3')
AGATTCTCGGCAAGCCTATGATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTTTGCCCTTTCCCATGTTC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 600+900
Approximate temperature
55°C
  
PCR data   Exp. ID 12701
Forward primer (5'-3')
AGATTCTCGGCAAGCCTATGATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTTTGCCCTTTCCCATGTTC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 850+550
Approximate temperature
55°C
  
PCR data   Exp. ID 12702
Forward primer (5'-3')
AGATTCTCGGCAAGCCTATGATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTTTGCCCTTTCCCATGTTC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 750+550
Approximate temperature
55°C
  
PCR data   Exp. ID 12703
Forward primer (5'-3')
AGATTCTCGGCAAGCCTATGATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTTTGCCCTTTCCCATGTTC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 600+800
Approximate temperature
55°C
  
PCR data   Exp. ID 12704
Forward primer (5'-3')
AGATTCTCGGCAAGCCTATGATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTTTGCCCTTTCCCATGTTC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 32794
Forward primer (5'-3')
AGATTCTCGGCAAGCCTATGATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTTTGCCCTTTCCCATGTTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32795
Forward primer (5'-3')
AGATTCTCGGCAAGCCTATGATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTTTGCCCTTTCCCATGTTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1100+350
Approximate temperature
55°C
  
PCR data   Exp. ID 32796
Forward primer (5'-3')
AGATTCTCGGCAAGCCTATGATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTTTGCCCTTTCCCATGTTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32797
Forward primer (5'-3')
AGATTCTCGGCAAGCCTATGATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTTTGCCCTTTCCCATGTTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 10267
Forward primer (5'-3')
AGATTCTCGGCAAGCCTATGATCC
Digested band sizes (using DpnII)
Solanum lycopersicum LA925: 700+500
Solanum pennellii LA716: 650
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTTTGCCCTTTCCCATGTTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: TaqI,DpnII
All possible enzymes for lycopersicum and pimpinellifolium: DpnII
  
Accessions and product sizes
Solanum lycopersicum LA925: 1800
Solanum pennellii LA716: 1800
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g53000  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6856 marker 6856
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)