SGN Marker C2_At1g53670

SGN-M6862
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U200066---
Lycopersicon CombinedMultipleSGN-U216219---
Solanum tuberosumSingleSGN-U253178---
ArabidopsisSingleAt1g53670 on TAIR---
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132180)
Chromosome
7
Position
62.38 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Solanum michoacanum 2011   
Map version
155 (location: 109224)
Chromosome
7S
Position
46.58 cM
Confidence
uncalculated
Protocol
CAPS


Solanum michoacanum 2011

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46591)
Chromosome
7
Position
13.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Eggplant-COSII   
Map version
63 (location: 42186)
Chromosome
7
Position
89.90 cM
Confidence
F(LOD3)
Protocol
PCR


Eggplant-COSII

PCR data   Exp. ID 43750
Forward primer (5'-3')
AAGGGTACAGAACGGGCATTCAC
Accessions and product sizes
Approximate temperature
60°C
Reverse primer (5'-3')
TGTTCCAGGGGTCTTACTGTTCCAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41333)
Chromosome
7
Position
108.90 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43309
Forward primer (5'-3')
AAGGGTACAGAACGGGCATTCAC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGTTCCAGGGGTCTTACTGTTCCAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38201)
Chromosome
7
Position
54.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39479
Forward primer (5'-3')
AAGGGTACAGAACGGGCATTCAC
Accessions and product sizes
Solanum pennellii TA56
1350
Solanum lycopersicum TA209
1350
Approximate temperature
55°C
Reverse primer (5'-3')
TGTTCCAGGGGTCTTACTGTTCCAG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
600
Solanum pennellii TA56
850
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25271)
Chromosome
1
Position
20.04 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10268
Forward primer (5'-3')
AAGGGTACAGAACGGGCATTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTCCAGGGGTCTTACTGTTCCAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 10269
Forward primer (5'-3')
AAGGGTACAGAACGGGCATTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTCCAGGGGTCTTACTGTTCCAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 10270
Forward primer (5'-3')
AAGGGTACAGAACGGGCATTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTCCAGGGGTCTTACTGTTCCAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12705
Forward primer (5'-3')
AAGGGTACAGAACGGGCATTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTCCAGGGGTCTTACTGTTCCAG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1000+1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12706
Forward primer (5'-3')
AAGGGTACAGAACGGGCATTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTCCAGGGGTCTTACTGTTCCAG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 12707
Forward primer (5'-3')
AAGGGTACAGAACGGGCATTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTCCAGGGGTCTTACTGTTCCAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 12708
Forward primer (5'-3')
AAGGGTACAGAACGGGCATTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTCCAGGGGTCTTACTGTTCCAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1000+1100
Approximate temperature
55°C
  
PCR data   Exp. ID 12709
Forward primer (5'-3')
AAGGGTACAGAACGGGCATTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTCCAGGGGTCTTACTGTTCCAG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12710
Forward primer (5'-3')
AAGGGTACAGAACGGGCATTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTCCAGGGGTCTTACTGTTCCAG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12711
Forward primer (5'-3')
AAGGGTACAGAACGGGCATTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTCCAGGGGTCTTACTGTTCCAG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 12712
Forward primer (5'-3')
AAGGGTACAGAACGGGCATTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTCCAGGGGTCTTACTGTTCCAG
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 12713
Forward primer (5'-3')
AAGGGTACAGAACGGGCATTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTCCAGGGGTCTTACTGTTCCAG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 32798
Forward primer (5'-3')
AAGGGTACAGAACGGGCATTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTCCAGGGGTCTTACTGTTCCAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 32799
Forward primer (5'-3')
AAGGGTACAGAACGGGCATTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTCCAGGGGTCTTACTGTTCCAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1000+1100
Approximate temperature
55°C
  
PCR data   Exp. ID 32800
Forward primer (5'-3')
AAGGGTACAGAACGGGCATTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTCCAGGGGTCTTACTGTTCCAG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 10271
Forward primer (5'-3')
AAGGGTACAGAACGGGCATTCAC
Digested band sizes (using amplicon difference)
Solanum lycopersicum LA925: 1200
Solanum pennellii LA716: 1100
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTCCAGGGGTCTTACTGTTCCAG
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
All possible enzymes for lycopersicum and pimpinellifolium: AluI
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Solanum pennellii LA716: 1100
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g53670  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6862 marker 6862
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)