SGN Marker SSR15

SGN-M688

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 40 High: 55
Repeat motif: CT   Repeat number: 12
Repeat motif:    Repeat number:
Forward primer: CACTTGCCATCTTCTAGCCC
Reverse primer: ATGGATGCCCAAATTGAAGA
Predicted size: 192
Derivations 
This marker was derived from EST read SGN-E119824
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53490)
Chromosome
8
Position
27.04 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2009

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39178)
Chromosome
8
Position
22.70 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14129
Forward primer (5'-3')
CACTTGCCATCTTCTAGCCC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
ATGGATGCCCAAATTGAAGA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 192+193
Solanum pimpinellifolium LA1589: 191+192
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR15 was used as an overgo probe on plate 13 [well D1]

Plausible BAC Matches:   P258E02,   P295H22,   P310K05,   P327N07,   P200K21,   P011I19,   P295M05,   P162M24,   P318I24,   P234K09,   P305P06,   P221H24,   P211D23,   P295F22,   P189M07,   P232J11,   P098H04,   P093P04

 Overgo Sequences

A sequence
AACCAGCTCCTGAACATACTACCG
B sequence
GTGGTGTCTGGTTCTACGGTAGTA
AB sequence
AACCAGCTCCTGAACATACTACCGTAGAAC
Marker sequence
GCCAACTATCATTCATCCCCATGCCCTGATCCCACCCACCACTTGCCATC
TTCTAGCCCCTCTCTCTCTCTCTCTCTCTCTCTCCTCTGCTTTTACTAGT
ATCTACAAACTCTCTTCAATACCACTCTCCAATCTGTGCTCTCCACTTTA
ACTTCCATTTTTCTCTCTCTAGAAAATCACCATGTTTGATGATTCTGTAT
CTACTGTGTATTCTTCAATTTGGGCATCCATGAATAGCTGGTTCACTCCA
ACTGTTCTTTTTGTTCTTCTCAATGTTATGATAGGTACCATTGCTTTTAC
TTCTTCCTTAGCTAACCAAAAACATAATCATCCAAAACAACAAGAAGACA
ACTCACATCAACAGGAAGATTACTCACAAAATCGACAACAGCCCACTAAA
CTTGTGAGATCTCCTTCTCTTCTTCAACGCATCAAATCCATTAATTTCGC
CAATTACAGATCTCATGAACATCCCCATCAGCAAGAAACCCCACCATTTG
AACCACCAACACATTACATTTTTGAACCAGCTCCTGAACATACTACCGTA
GAACCAGACACCACCACCACCCAGTATGTTTTCAATCAAGACAAGAATGT
CCAAAAGCCACAAACCCACTACGATTTCCAG
Genomic location of SSR15  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D688 marker 688
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)