SGN Marker C2_At1g55870

SGN-M6887
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle305006 (SGN)
123586 (CGN)
---
Capsicum annuumSingleSGN-U202262---
Lycopersicon CombinedSingleSGN-U228097---
Solanum tuberosumMultipleSGN-U247566---
ArabidopsisSingleAt1g55870 on TAIR---
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42188)
Chromosome
7
Position
108.90 cM
Confidence
I(LOD2)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43752
Forward primer (5'-3')
AAGTTCGCCGTCGTTCAGTTCG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATTGGTTGCTACCAGGAATTTCTTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38209)
Chromosome
7
Position
90.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39484
Forward primer (5'-3')
AAGTTCGCCGTCGTTCAGTTCG
Accessions and product sizes
Solanum lycopersicum TA209
750
Solanum pennellii TA56
750
Approximate temperature
55°C
Reverse primer (5'-3')
ATTGGTTGCTACCAGGAATTTCTTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25297)
Chromosome
1
Position
20.90 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10282
Forward primer (5'-3')
AAGTTCGCCGTCGTTCAGTTCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGGTTGCTACCAGGAATTTCTTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 10283
Forward primer (5'-3')
AAGTTCGCCGTCGTTCAGTTCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGGTTGCTACCAGGAATTTCTTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 10284
Forward primer (5'-3')
AAGTTCGCCGTCGTTCAGTTCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGGTTGCTACCAGGAATTTCTTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12201
Forward primer (5'-3')
ATTTATTCCACGCTCCGACCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGTTGTCTGGCAAAGGAACTCAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 12202
Forward primer (5'-3')
ATTTATTCCACGCTCCGACCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGTTGTCTGGCAAAGGAACTCAC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 12203
Forward primer (5'-3')
ATTTATTCCACGCTCCGACCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGTTGTCTGGCAAAGGAACTCAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 12204
Forward primer (5'-3')
ATTTATTCCACGCTCCGACCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGTTGTCTGGCAAAGGAACTCAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 150+1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12205
Forward primer (5'-3')
ATTTATTCCACGCTCCGACCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGTTGTCTGGCAAAGGAACTCAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 12206
Forward primer (5'-3')
ATTTATTCCACGCTCCGACCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGTTGTCTGGCAAAGGAACTCAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 200+350
Approximate temperature
55°C
  
PCR data   Exp. ID 12207
Forward primer (5'-3')
ATTTATTCCACGCTCCGACCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGTTGTCTGGCAAAGGAACTCAC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 12208
Forward primer (5'-3')
ATTTATTCCACGCTCCGACCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGTTGTCTGGCAAAGGAACTCAC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12715
Forward primer (5'-3')
AAGTTCGCCGTCGTTCAGTTCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGGTTGCTACCAGGAATTTCTTG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 12716
Forward primer (5'-3')
AAGTTCGCCGTCGTTCAGTTCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGGTTGCTACCAGGAATTTCTTG
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 1050
Approximate temperature
55°C
  
PCR data   Exp. ID 12717
Forward primer (5'-3')
AAGTTCGCCGTCGTTCAGTTCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGGTTGCTACCAGGAATTTCTTG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 12718
Forward primer (5'-3')
AAGTTCGCCGTCGTTCAGTTCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGGTTGCTACCAGGAATTTCTTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 12719
Forward primer (5'-3')
AAGTTCGCCGTCGTTCAGTTCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGGTTGCTACCAGGAATTTCTTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 12720
Forward primer (5'-3')
AAGTTCGCCGTCGTTCAGTTCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGGTTGCTACCAGGAATTTCTTG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12721
Forward primer (5'-3')
AAGTTCGCCGTCGTTCAGTTCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGGTTGCTACCAGGAATTTCTTG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 12722
Forward primer (5'-3')
AAGTTCGCCGTCGTTCAGTTCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGGTTGCTACCAGGAATTTCTTG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 12723
Forward primer (5'-3')
AAGTTCGCCGTCGTTCAGTTCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGGTTGCTACCAGGAATTTCTTG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12724
Forward primer (5'-3')
AAGTTCGCCGTCGTTCAGTTCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGGTTGCTACCAGGAATTTCTTG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12725
Forward primer (5'-3')
AAGTTCGCCGTCGTTCAGTTCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGGTTGCTACCAGGAATTTCTTG
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 12726
Forward primer (5'-3')
AAGTTCGCCGTCGTTCAGTTCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGGTTGCTACCAGGAATTTCTTG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 12727
Forward primer (5'-3')
AAGTTCGCCGTCGTTCAGTTCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGGTTGCTACCAGGAATTTCTTG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 32803
Forward primer (5'-3')
AAGTTCGCCGTCGTTCAGTTCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGGTTGCTACCAGGAATTTCTTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 32804
Forward primer (5'-3')
AAGTTCGCCGTCGTTCAGTTCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGGTTGCTACCAGGAATTTCTTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 32805
Forward primer (5'-3')
AAGTTCGCCGTCGTTCAGTTCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGGTTGCTACCAGGAATTTCTTG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 32806
Forward primer (5'-3')
AAGTTCGCCGTCGTTCAGTTCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGGTTGCTACCAGGAATTTCTTG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 33320
Forward primer (5'-3')
ATTTATTCCACGCTCCGACCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGTTGTCTGGCAAAGGAACTCAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 33321
Forward primer (5'-3')
ATTTATTCCACGCTCCGACCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGTTGTCTGGCAAAGGAACTCAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 150+1200
Approximate temperature
55°C
  
PCR data   Exp. ID 33322
Forward primer (5'-3')
ATTTATTCCACGCTCCGACCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGTTGTCTGGCAAAGGAACTCAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 33323
Forward primer (5'-3')
ATTTATTCCACGCTCCGACCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGTTGTCTGGCAAAGGAACTCAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 200+350
Approximate temperature
55°C
  
PCR data   Exp. ID 10285
Forward primer (5'-3')
AAGTTCGCCGTCGTTCAGTTCG
Digested band sizes (using amplicon difference)
Solanum pennellii LA716: 850
Solanum lycopersicum LA925: 750
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGGTTGCTACCAGGAATTTCTTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
All possible enzymes for lycopersicum and pimpinellifolium: amplicon difference
  
Accessions and product sizes
Solanum pennellii LA716: 850
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g55870  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6887 marker 6887
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)