SGN Marker C2_At1g56450

SGN-M6895
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309307 (SGN)
132329 (CGN)
---
Capsicum annuumSingleSGN-U197070---
Lycopersicon CombinedSingleSGN-U215895---
Solanum tuberosumSingleSGN-U244919---
ArabidopsisSingleAt1g56450 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38213)
Chromosome
11
Position
76.40 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41118
Forward primer (5'-3')
ACTTGTTCTTGGTGGAGTAAAAAATGG
Accessions and product sizes
Solanum pennellii TA56
1600
Solanum lycopersicum TA209
1600
Approximate temperature
55°C
Reverse primer (5'-3')
ACTCCCTCTTCTGTGATTTTTGCAATCTG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
900
Solanum pennellii TA56
1600
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25305)
Chromosome
1
Position
21.15 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10294
Forward primer (5'-3')
TCTCTTGGCAGCTGACATGGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCACCAAGAAGGGAGTGTTTTCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 300
Approximate temperature
50°C
  
PCR data   Exp. ID 10295
Forward primer (5'-3')
TCTCTTGGCAGCTGACATGGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCACCAAGAAGGGAGTGTTTTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 300
Approximate temperature
50°C
  
PCR data   Exp. ID 10296
Forward primer (5'-3')
TCTCTTGGCAGCTGACATGGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCACCAAGAAGGGAGTGTTTTCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 300
Approximate temperature
50°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At1g56450  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6895 marker 6895
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)