SGN Marker TG505

SGN-M69

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1200
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG505 image not available
Forward sequence
TCTAATCTGTGGCTGAAGAAGAGTTTCTCTAAATTTACAAAAAGAAATAAAGTGGATGTTAAAAATGAGAAAGAAAGATTACCCATCTAT
CCCAAACTAACTGCTTTACTTTCTTTTGATTGTCCCCAAACTTTGTCACTTCTCTGAATAGGTTCTCTACAATCTTTTGTACCTTTTCAA
TATATAATACTGCAAGAGATCACACATATGACTTTTTTTCCTGAAATGGTAAATGTTATTGATGTCAAAACTAGCAATTAGAAAGTGTTG
TGATAACATCCAAAAAGTTAAGGGAAAGAAAACCCTGGGTATCTATACAAAAGATCCAATGAGTTGTAACAGGGTATCATTATCCTCAAT
CTGCCATTCCCTTCTATACCAAGTTATGAACAAATTTGATCTTCACGATTGAGTTGTTCCTCGCTTCAAAGAACCTCGGGTTTCTTTCTT
T
Reverse sequence
GCATGCCTGCAGTCATTGTAGGGCAGTTCTCTGGTGTACAGAACTCGGTCAACGTGCCATAAAGCAGATTCACCTGGTTGAAGAAATCGA
CAGCTGGATATTACAAGATAAAGCCTCCATTCAGTTTTGAAATTTAGATTCAATAATAGCAACAACTCACCAAAGAAACAAAATTAATGT
GTGTGTGAGCATTATGAGAGCAATGATAACATAGTATATGAAGCACTCTGTTCTCACAATTGGCTTCAAAGGGAACTCACATGTAAGCAG
AGCATGAAAGTTTCTATCTAGAATTCTTTCTGCTGCAATTCATTTTAGTTTGTACCAGCCTTTAAACATCATTAAAAAGTCTAACTGTTA
GTAAGCAAATCATCAAAAGTTGTTGTACAAAATGTGAATTAATAACACTTGGTGGAACTTCTTAGGTATGGTATGTTCATGTGGCATTTG
GCTGCCGAAAATAGAGATCAAGCTACTACATAATTTAAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1563872e-151290 (64.3% of RFLP seq)+
SGN-U1452422.9e-2789 (18.2% of RFLP seq)-
SGN-U1452415.6e-4489 (18.2% of RFLP seq)-
SGN-U156387469 (95.9% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 7944)
Chromosome
8
Position
50.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 7945)
Chromosome
8
Position
53.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG505 was used as an overgo probe on plate 12 [well D8]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P178N09,   P244O02,   P015O16,   P175G05,   P181E02,   P006A17

 Overgo Sequences

A sequence
ACGATTGAGTTGTTCCTCGCTTCA
B sequence
GAAACCCGAGGTTCTTTGAAGCGA
AB sequence
ACGATTGAGTTGTTCCTCGCTTCAAAGAAC
Marker sequence
TCTAATCTGTGGCTGAAGAAGAGTTTCTCTAAATTTACAAAAAGAAATAA
AGTGGATGTTAAAAATGAGAAAGAAAGATTACCCATCTATCCCAAACTAA
CTGCTTTACTTTCTTTTGATTGTCCCCAAACTTTGTCACTTCTCTGAATA
GGTTCTCTACAATCTTTTGTACCTTTTCAATATATAATACTGCAAGAGAT
CACACATATGACTTTTTTTCCTGAAATGGTAAATGTTATTGATGTCAAAA
CTAGCAATTAGAAAGTGTTGTGATAACATCCAAAAAGTTAAGGGAAAGAA
AACCCTGGGTATCTATACAAAAGATCCAATGAGTTGTAACAGGGTATCAT
TATCCTCAATCTGCCATTCCCTTCTATACCAAGTTATGAACAAATTTGAT
CTTCACGATTGAGTTGTTCCTCGCTTCAAAGAACCTCGGGTTTCTTTCTT
T
Genomic location of TG505  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D69 marker 69
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)