SGN Marker C2_At1g60440

SGN-M6909
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U197812---
Solanum tuberosumSingleSGN-U252374---
ArabidopsisSingleAt1g60440 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46596)
Chromosome
10
Position
53.40 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Eggplant-COSII   
Map version
63 (location: 42190)
Chromosome
3
Position
56.40 cM
Confidence
I(LOD2)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43754
Forward primer (5'-3')
TGCCCGGTCCCTCTTAAGGATG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCCGCTTGAGCCCAAAACGAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41336)
Chromosome
11
Position
57.80 cM
Confidence
I
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43312
Forward primer (5'-3')
AGGAGAAGAACGGATAGCTAATCCAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCCGCTTGAGCCCAAAACGAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38217)
Chromosome
5
Position
0.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39490
Forward primer (5'-3')
TGCCCGGTCCCTCTTAAGGATG
Accessions and product sizes
Solanum lycopersicum TA209
150
Solanum pennellii TA56
150
Approximate temperature
55°C
Reverse primer (5'-3')
TCCGCTTGAGCCCAAAACGAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25320)
Chromosome
1
Position
22.27 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10308
Forward primer (5'-3')
TGCCCGGTCCCTCTTAAGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCGCTTGAGCCCAAAACGAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 10309
Forward primer (5'-3')
TGCCCGGTCCCTCTTAAGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCGCTTGAGCCCAAAACGAAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 10310
Forward primer (5'-3')
TGCCCGGTCCCTCTTAAGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCGCTTGAGCCCAAAACGAAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12731
Forward primer (5'-3')
TGCCCGGTCCCTCTTAAGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCGCTTGAGCCCAAAACGAAG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 920
Approximate temperature
55°C
  
PCR data   Exp. ID 12732
Forward primer (5'-3')
TGCCCGGTCCCTCTTAAGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCGCTTGAGCCCAAAACGAAG
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 920
Approximate temperature
55°C
  
PCR data   Exp. ID 12733
Forward primer (5'-3')
TGCCCGGTCCCTCTTAAGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCGCTTGAGCCCAAAACGAAG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 920
Approximate temperature
55°C
  
PCR data   Exp. ID 12734
Forward primer (5'-3')
TGCCCGGTCCCTCTTAAGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCGCTTGAGCCCAAAACGAAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 12735
Forward primer (5'-3')
TGCCCGGTCCCTCTTAAGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCGCTTGAGCCCAAAACGAAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 12736
Forward primer (5'-3')
TGCCCGGTCCCTCTTAAGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCGCTTGAGCCCAAAACGAAG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 920
Approximate temperature
55°C
  
PCR data   Exp. ID 12737
Forward primer (5'-3')
TGCCCGGTCCCTCTTAAGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCGCTTGAGCCCAAAACGAAG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 920
Approximate temperature
55°C
  
PCR data   Exp. ID 12738
Forward primer (5'-3')
TGCCCGGTCCCTCTTAAGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCGCTTGAGCCCAAAACGAAG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12739
Forward primer (5'-3')
TGCCCGGTCCCTCTTAAGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCGCTTGAGCCCAAAACGAAG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 850+920
Approximate temperature
55°C
  
PCR data   Exp. ID 12740
Forward primer (5'-3')
TGCCCGGTCCCTCTTAAGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCGCTTGAGCCCAAAACGAAG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12741
Forward primer (5'-3')
TGCCCGGTCCCTCTTAAGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCGCTTGAGCCCAAAACGAAG
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12742
Forward primer (5'-3')
TGCCCGGTCCCTCTTAAGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCGCTTGAGCCCAAAACGAAG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12743
Forward primer (5'-3')
TGCCCGGTCCCTCTTAAGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCGCTTGAGCCCAAAACGAAG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 32809
Forward primer (5'-3')
TGCCCGGTCCCTCTTAAGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCGCTTGAGCCCAAAACGAAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 32810
Forward primer (5'-3')
TGCCCGGTCCCTCTTAAGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCGCTTGAGCCCAAAACGAAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 32811
Forward primer (5'-3')
TGCCCGGTCCCTCTTAAGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCGCTTGAGCCCAAAACGAAG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 920
Approximate temperature
55°C
  
PCR data   Exp. ID 32812
Forward primer (5'-3')
TGCCCGGTCCCTCTTAAGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCGCTTGAGCCCAAAACGAAG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 920
Approximate temperature
55°C
  
PCR data   Exp. ID 10311
Forward primer (5'-3')
TGCCCGGTCCCTCTTAAGGATG
Digested band sizes (using HinfI)
Solanum pennellii LA716: 850
Solanum lycopersicum LA925: 400+450
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCGCTTGAGCCCAAAACGAAG
Enzymes
All possible enzymes for pennellii and and lycopersicum: MspI, EcoRV, HaeIII, HinfI, DpnII
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Solanum pennellii LA716: 850
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Forward amplicon sequence for , AB1 chromatogram - [View]
Forward amplicon sequence for , plain text
Forward amplicon sequence for , AB1 chromatogram - [View]
Forward amplicon sequence for , plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for Petunia axillaris parodii TA3310, AB1 chromatogram - [View]
Forward amplicon sequence for Petunia axillaris parodii TA3310, plain text
Forward amplicon sequence for C. canephora BP409, AB1 chromatogram - [View]
Forward amplicon sequence for C. canephora BP409, plain text
Reverse amplicon sequence for , AB1 chromatogram - [View]
Reverse amplicon sequence for , plain text
Reverse amplicon sequence for , AB1 chromatogram - [View]
Reverse amplicon sequence for , plain text
Reverse amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Reverse amplicon sequence for S. lycopersicum TA209, plain text
Reverse amplicon sequence for Petunia axillaris parodii TA3310, AB1 chromatogram - [View]
Reverse amplicon sequence for Petunia axillaris parodii TA3310, plain text
Reverse amplicon sequence for C. canephora BP409, AB1 chromatogram - [View]
Reverse amplicon sequence for C. canephora BP409, plain text


BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Forward amplicon sequence for , AB1 chromatogram - [View]
Forward amplicon sequence for , plain text
Forward amplicon sequence for , AB1 chromatogram - [View]
Forward amplicon sequence for , plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for Petunia axillaris parodii TA3310, AB1 chromatogram - [View]
Forward amplicon sequence for Petunia axillaris parodii TA3310, plain text
Forward amplicon sequence for C. canephora BP409, AB1 chromatogram - [View]
Forward amplicon sequence for C. canephora BP409, plain text
Reverse amplicon sequence for , AB1 chromatogram - [View]
Reverse amplicon sequence for , plain text
Reverse amplicon sequence for , AB1 chromatogram - [View]
Reverse amplicon sequence for , plain text
Reverse amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Reverse amplicon sequence for S. lycopersicum TA209, plain text
Reverse amplicon sequence for Petunia axillaris parodii TA3310, AB1 chromatogram - [View]
Reverse amplicon sequence for Petunia axillaris parodii TA3310, plain text
Reverse amplicon sequence for C. canephora BP409, AB1 chromatogram - [View]
Reverse amplicon sequence for C. canephora BP409, plain text

Genomic location of C2_At1g60440  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6909 marker 6909
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)