SGN Marker SSR19

SGN-M692

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 55
Repeat motif: AT   Repeat number: 16
Repeat motif:    Repeat number:
Forward primer: CCGTTACCTTGGTCCATCAC
Reverse primer: GGGAGATGCCACATCACATA
Predicted size: 188
Derivations 
This marker was derived from EST read SGN-E116243
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 52835)
Chromosome
9
Position
36.38 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_9
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39185)
Chromosome
9
Position
51.00 cM
Confidence
CF(LOD3)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14136
Forward primer (5'-3')
CCGTTACCTTGGTCCATCAC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GGGAGATGCCACATCACATA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 185+188
Solanum pimpinellifolium LA1589: 178+188
Approximate temperature
50°C
  
PCR data   Exp. ID 115
Forward primer (5'-3')
CCGTTACCTTGGTCCATCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GGGAGATGCCACATCACATA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 174+186
Solanum lycopersicum LA925: 186+186
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR19 was used as an overgo probe on plate 7 [well H8]

Plausible BAC Matches:   P097O24,   P255F02,   P005A01,   P002N16

 Overgo Sequences

A sequence
AAGGCTGTTTCTGCTGTCGGGAAA
B sequence
ACTTTTCTCCTCCAGCTTTCCCGA
AB sequence
AAGGCTGTTTCTGCTGTCGGGAAAGCTGGA
Marker sequence
GGCAAAGAAAGATCCTAATAAGCCTAAGAGGCCTCCCAGTGCCTTTTTCG
TGTTCCTTGAGGAATTTAGGAAGACATTTAAAAAGGAGAATCCTAATGTG
AAGGCTGTTTCTGCTGTCGGGAAAGCTGGAGGAGAAAAGTGGAAATCTTT
GAGTGCAGCTGAAAAAGCACCATATGAAGCCAAAGCTGCAAAAAGGAAGG
CAGAGTATGGAAAACTCATGAATGCTTATAACAATAAGCAGGTGGAAAGC
TCAGATGATGAGGACGAAGAAGAAAAAGAAGAAGAAAAAGAGAAAAGGTC
AAAGCCTGAGGTACATGATGAAGATGCGGAGGACAGTGGACAGGGCGAAG
AAGAGGAAGAGGACGATGAAGACGAAGAGGATGAAGATGAGGAAGATGAT
TGAAGCTATGTAATTTCTGGCTTGCACCGTTACCTTGGTCCATCACATGC
ACACTTCAAACATAATAGTTTTCGTAATTCTGTTACCTAAACCTATGTAT
TTTCTGTTACCTAGTTGAGTTTTGCAGTTTGCTGAAACTCTCAACTCTTG
TGAACTCATATATATATATATATATATATATATATATATGACGATATGTG
ATGTGGCATCTCCCCTTGCTTTG
Genomic location of SSR19  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D692 marker 692
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)