SGN Marker SSR20

SGN-M693

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 45.455 High: 50
Repeat motif: GAA   Repeat number: 8
Repeat motif:    Repeat number:
Forward primer: GAGGACGACAACAACAACGA
Reverse primer: GACATGCCACTTAGATCCACAA
Predicted size: 157
Derivations 
This marker was derived from EST read SGN-E115866
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53491)
Chromosome
12
Position
30.05 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2009

Map: Sun1642 x LA1589   
Map version
85 (location: 43785)
Chromosome
12
Position
34.40 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44788
Forward primer (5'-3')
GAGGACGACAACAACAACGA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GACATGCCACTTAGATCCACAA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43245)
Chromosome
12
Position
41.00 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44602
Forward primer (5'-3')
GAGGACGACAACAACAACGA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GACATGCCACTTAGATCCACAA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-LXCHM 2007   
Map version
68 (location: 42989)
Chromosome
12
Position
38.30 cM
Confidence
uncalculated
Protocol
SSR


Tomato-LXCHM 2007

PCR data   Exp. ID 43989
Forward primer (5'-3')
GAGGACGACAACAACAACGA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GACATGCCACTTAGATCCACAA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40761)
Chromosome
12
Position
37.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39187)
Chromosome
12
Position
58.20 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 151
Forward primer (5'-3')
GAGGACGACAACAACAACGA
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GACATGCCACTTAGATCCACAA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 157+157
Solanum pennellii LA716: 148+157
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR20 was used as an overgo probe on plate 14 [well G5]

Plausible BAC Matches:   P011D14,   P150C12

 Overgo Sequences

A sequence
GAGAGCCCTAAGATTGTGGATCTA
B sequence
CCAATGACATGCCACTTAGATCCA
AB sequence
GAGAGCCCTAAGATTGTGGATCTAAGTGGC
Marker sequence
GCTATGTGTTTGTGTCACCACACACAAGTAACGACCCCTCAATTTGTCAA
TAAACAAATAAGAGGAGTTGTTGATTATCAAAGGAAGAAGAAGAAGATTA
TGAAATTTCAATGATGATTTGTGTTAGGGTTAAGAGATTATGAAGATGAG
AATGGAATTAGTTGAACGACGAGGACGACAACAACAACGACAAGAAGAAA
AAGGAGCATTTGAGAGGAAGAGTAGTAGGGAAAAAAGTACAAGAAGAAGG
ATGACAATTAGTATTGTGGAAGAAGAAGAAGAAGAAGAAGAAGAGAGCCC
TAAGATTGTGGATCTAAGTGGCATGTCATTGGATTTTATTCCTGTAAATC
CTACTATAAATTTGGGAGCTATATCCAAATTACATATTTCCAACAATAAT
CTTCAGAGTATACCAGAGTCTTTAACAGCAAGACTACTAAACTTGGTTGA
GTTAGATATGCACTCAAATCAGCTCAACTCCATTCCTAACTCAATAGGTT
GCTTATCGAAGCTCATACTTCTCAACATTTCTGGGAATCTTCTTCTTTCG
CTCCCTAAAACTATCGAGAATTGCAGAGCATTGGAAGAGTTGAATGCCGA
TTTCAATATGCTTACTCATTTACCGGACAC
Genomic location of SSR20  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D693 marker 693
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)