SGN Marker C2_At1g62780

SGN-M6930
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300060 (SGN)
120768 (CGN)
---
Capsicum annuumSingleSGN-U203118---
Lycopersicon CombinedSingleSGN-U215734---
Solanum tuberosumMultipleSGN-U246008---
ArabidopsisSingleAt1g62780 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46600)
Chromosome
8
Position
71.10 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46448)
Chromosome
8
Position
83.00 cM
Confidence
F(LOD3)
Protocol
dCAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38224)
Chromosome
8
Position
63.20 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39496
Forward primer (5'-3')
ACTTTTGTAAACACAATTCGCTG
Accessions and product sizes
Solanum pennellii TA56
2000
Solanum lycopersicum TA209
2000
Approximate temperature
55°C
Reverse primer (5'-3')
TCGTGGTCTCATTCTTGCAATCTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
475
Solanum lycopersicum TA209
400
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25342)
Chromosome
1
Position
23.25 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10325
Forward primer (5'-3')
ACTTTTGTAAACACAATTCGCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGTGGTCTCATTCTTGCAATCTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 10326
Forward primer (5'-3')
ACTTTTGTAAACACAATTCGCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGTGGTCTCATTCTTGCAATCTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 10327
Forward primer (5'-3')
ACTTTTGTAAACACAATTCGCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGTGGTCTCATTCTTGCAATCTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32604
Forward primer (5'-3')
ACTTTTGTAAACACAATTCGCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGTGGTCTCATTCTTGCAATCTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 32822
Forward primer (5'-3')
ACTTTTGTAAACACAATTCGCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGTGGTCTCATTCTTGCAATCTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 32823
Forward primer (5'-3')
ACTTTTGTAAACACAATTCGCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGTGGTCTCATTCTTGCAATCTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1500
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g62780  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6930 marker 6930
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)