SGN Marker C2_At1g64550

SGN-M6948
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300378 (SGN)
122977 (CGN)
---
Capsicum annuumSingleSGN-U201919---
ArabidopsisSingleAt1g64550 on TAIR---
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132182)
Chromosome
8b
Position
63.90 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38231)
Chromosome
8
Position
87.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39503
Forward primer (5'-3')
AGCTTCAACCAATTTCAGGGACTGTT
Accessions and product sizes
Solanum pennellii TA56
1200
Solanum lycopersicum TA209
1200
Approximate temperature
55°C
Reverse primer (5'-3')
TTGAGGACAGATCCAGCCCATCAAC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
950
Solanum lycopersicum TA209
1200
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25361)
Chromosome
1
Position
23.97 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g64550  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6948 marker 6948
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)